Transcript

krt222-201

ID
ZDB-TSCRIPT-090929-15022
Name
krt222-201
Previous Names
  • krt222-001
  • si:ch73-78i5.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000034122 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000034122|OTTDARG00000025830|ZDB-GENE-070912-343 krt222|OTTDARP00000027532 CH73-78I5.3-001 LG_ CU041376.9 Danio rerio protein_coding NOVEL, 2474 bp
GCAGAGCTTTTGATACAGTCTGATGCAGTCAATCTGAAGG
CAGCACATTTAAAAAACAGGTGTGAAACTGAGGAGAATCT
GCGTCTCCTACAAGAGCAGGATGTGTTACAGCTGAAGACC
AAGAAGAACGAGGTTGAAACAACCAACAGGCTTCTGGAAA
AGCAGATCCTTGAAACTGAACATGAGTTGCAGCAAACCAT
TGAGGAACATGAGAGAGAGCTGGATCAGCACCAGCAGCGA
ACAGCAGAGGAGTGTGATAGAGTGCTAGCGCAGGTTGCTG
CAGGAGAGGATGGCAGAGGAATGGATCTCTCCCGGACCAG
CACCCAGTGCGACCACTCCAGCCCAGCCCAGAGCAGCCCT
GACTCAGCCACACCACCAACTCAAGCCTCAGGCTCCGGCC
CAGCTCCAAAGAGAAGGCCTCGAAAGGATGCAGTCAGTCC
CACAGTTGTGTTTCCGCCACAGGTGAAAGCAAGTGATGGG
GCCCTGAAGGAGGCACGAGCCGAGCTCGCCGAGGCCCGAA
AGCGATGGCACCGTCTACAAGTGGAGATAGAATCGCTACA
TGCCTTGGAAAGGAGTCTCCAAAGCTCCTTACGCCACACT
CAGCTCCAGTACTCTGTGCAACTCCGTGATCTGTCCCGGT
CTGTGAAAGGTTTGGAGTCTGAGCTTGAAACTGTGCGGGA
TGGCCTGGAAGTCCAGAAAGAGAGTCACAACCAGCTCCTC
AACACCAAGATGAGGCTGGAGAAAGAGATTGCTACCTATA
GGAAACTCCTTGAACACGAGGAGGGCAGGTTTCTGAACTC
TGATGGTCGGTCAGTACAGCTGAAGCCCTGGAAAGGGTCA
GATCCTGCTCCAGAGCAGAACGGCCTACCCAATGGATGTG
ATGAGGGCATCGCTGATCCGTTCTTCACGGAGAAAACTCC
AAAAAGAAGCCCATCCCTTCAGCGTCAGCGCAGTCTTGTC
ATCCTGACAGAACCAGTCAGAAACAAAGATGGGGACATCT
GTACTGTGAAGACTCAGGAGTATCTGGAAGGAAATGTAGT
GAGGGAGAGTGCGGAGGGTCACGGAAACGTGGAGACAGAG
AAGATAGACAAGGTCATCAGGCAATGGGAAGGGTCATTCT
TTAAAGGAAATCCCAAGCTAAGGAAGAAGTCCGTGTCTCT
GCGTTTTGACCTTCACATGGCAGTGGCGGACGAGGGCTGC
AGCCAGATAAAACAGGACAGTCTCCCAAATGTGGAGGTCC
GTCTTGTCATGAGACGGTCTCGCAGCATACCCACCTTCGC
GCAGTGATGTCACAATGCTAGTACATCACATTTGTGACTT
CACCATGCTACTACTACATCACAACTGTGACCTCACAATG
CTACTGCATCACAATTAAGTAGTGGTGACCTTGTCTCAAT
GTCCCAGTGACTAAGGAAAGCCGATCACTTTAGTGACATG
CCATTTGAGAGGAAAAAAATTTCAATAATCAGCATTCGAA
AGCCCAAATTACTCTTATGATTGTAATGAACTCACTGCTA
CTTCTTTATCAGAAATATTGACTTAATTTTATTCAAACTT
TGGTCTTTGGATTTTAATGGAGAGTACGTATGTCTTGCGG
TGTTTAAAATTTCGTAAATTGTGGCTCTAGAGTGTGTTGC
TTTCGGTGGACGCTCTACTGTCATTATTTTTGATTATTAC
CATATATTACGTTACTGAGAAATCTAGAATAACTAGCCTA
TTGGTTTGTGAAAATGTGTTCAATTATAAACTTATCTCGT
GGAATCTTGAGTCTCAAGGTGAACAACAGGTCAATGTGGA
TACAGACAAGATTTCACATGCAGCGCAGAGTAACAAAAGA
CGCCTTTCTGCGTTTGACGAATGCTGCTGGAACTAATTTT
ACACTCCAGCGAATGCAAAGGGGGTATCATGTTCTGGTTC
CGCAGAAAACTGTAGTGGGAACCAAAACAAAATACTGCAG
GGTTTGCAAGAGCAGCAAAACCCAGCAGCCAAAACAAAAG
ATTTATGGTGACACCGATGTACTGTTTTCACAATATTGCC
TGCACTGACGTTTACAAAACGAGTAGCAGTAAAAGTCGTC
AGTCTATCACTGCGAAGCGAATGAAATGCTAAAAGTAAAT
AAACTGTTCTCGATGAACTTCTAAACTTAAAATTACACTC
ACCTCTAAAGGTTACGTATGACGGATGCATATAGTTTACG
CTTCATTTAAAATGCAAATACTGTGTCTTCCAATCTGAAA
TTATGCAGGATTGTTGGGAAAACTTGAAATGATCATTACT
TCAGCAACCAAAAAAATTGTTTCTCATCTGCATATGTTGA
TCATTTAATCTGATTTATTTACATACTCATTATGTTCTAC
CTCTGATGGTTGTTGTGTTGTAAATATATGGGGTTCTTCC
TGATGCAACAAATGGAAATGGATACATATATTTAAAGTTA
CATTGAATCTTAATAAATGTATATCTCTTAAATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations