Transcript

cnga4-202

ID
ZDB-TSCRIPT-090929-14963
Name
cnga4-202
Previous Names
  • cnga4-001
  • si:ch211-39h10.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000034058 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000034058|OTTDARG00000025797|ZDB-GENE-070912-292 cnga4|OTTDARP00000027497 CH211-39H10.2-001 LG_ CR936366.13 Danio rerio protein_coding NOVEL, 1953 bp
ATATTGTTAAAAGGACATGTTTCTATACAATTGAGGAGGC
ATATGTCGCAACATGGCTCACCTTGGATTACCTCTGTGAC
TTGGTTTATGTGCTTGACACAATTATTGGGTTTCGCACAG
GTTTTCTGGAGCAGGGTATCCTGGTGCGAGACTTGTCCCG
TTTAAAAACGCGTTATTTACGCTCCTCTCGCTTCAAGTGG
GACATGACCTCCCTGCTGCCCACGGATCTGCTCTACCTAC
AGCTGGGGATCCACACACCTCTGGTCCGGGTGAACCGCTT
CTTGCGCACAGGCCGTCTGAACGAGGCCCTGGACCGCATG
GAGACGCGCACATCCTTCCCGAACGCCTTCCGCGTTGCCA
AACTCATGCTGTATATCTTCGTCCTGATCCACTGGAACGC
ATGCATCTACTTCTCCCTGTCAAATTACATAGGGTTTGGC
GCGGACCCCTGGGTCTACCCCAATATCTCCCACCCGGAGT
TTGCCTCCATGAGACGCCAATACTTTTACTGCTTCTGGTT
TTCCACCCTCATCCTCACCACAGTGGGCGACACACCAACG
CCCGAGCGGGAAGAAGAGTATATGTTTCTGATCGCAGACA
TGTTGATCGCCGTGTTGGTGTTTGCTTCGGTCGTGGGCAG
CATGGGGGACGTGATTTCCAGCTTGCGTGACCGTGACAAT
GTGTTTTTTCCTGACCACGAGCTGGTGAAGGGTTACCTGC
GCAGCCACCGCATTAGCAAGGAGCTGCAGAAGCGCGTCAA
CGACTGGTATCAGCATCTGCACATCAACAAAAAGATCACA
CGGGAGAATGAGATTCTTCAACATCTTCCAATGACACTTC
AGACAGCCACTGCCGTGAGCGTGCATCTGCCCACTTTGTC
CAAAGTCACCATCTTCCAGAACTGCGAGAACAGTCTGTTG
GAGCAGCTGGTACTTAAACTCACCCCACAGGTGTACAGCC
CGGGTGAATACGTGTGCAAGAAGGGTGATGTAGGCCATGA
GATGTACATAATTAAAGAGGGTAAGCTGGCAGTGGTTGCA
GATGATGGAGTCACTCAGTTTGCAGTCCTCGGGGATGGAA
ACTTCTTTGGAGAAATCAGCATCCTAAATATCAAAGGTAA
CAAATCAGGAAACAGACGAACGGCCAACATTCGTAGCATT
GGATACTCAGATCTGTTCAGCCTATCAAAAGAGGACTTGA
CAGAAACCCTTCTGGAATACCCTGCTGCCAAGCGTCTGCT
GGAGGAGAAGGGTCGGCAGATCCTCACCAAAATGGGGATG
CTAGAAGAGGCTGTCGAAGGGGAGGGAGAGGTGGAGAAAA
CAGAGGACAAGGTGAACCGCCTAGAGGGCATCCTGGAGAT
GCTGCAAACCAAACTGGCCCGGCTGATCGCTGAACTGGAG
TCCAGTGCCCGCAAAATGATGCAGCGAGTAGATCAACTGG
AACTGCAGACCGAAGGATGGGAAGGCATTGTGGCAGAAGG
TGCACAGGTGGAGATAGAGGAGAGGGCAAAAATAAAAGAG
AGGGAGATTGGGGATGGAGAGGGTGAAGGTGAAAGAGAGA
AGGAGGATAAAGAGGAGCCTTTGGTGGAAGGAGAGAGAGG
AGAGGGTGATGGAGGAGAGGAAAGCCTGGGAGAAAAGGAC
AAGAATGTAGGAGGAAACGAGATAAATGAAGAAGAGAAAG
AGGAGAAAGAAATTATAAAGACAGAAACACAGCAGGATGA
GAAAGAAGATGAAAAGTAGGTAGAAAATCTATAAAATATC
ATTTCTATAGGTTTGAGGTCAGAGTGTTTATTTATTAATT
GCTTTATTTAGCAATGATTCATTAAGATCATTAAAAAGTG
AATACATGTAGAAAATGTACTTATACATGTAAATAATAAA
TGTTTGTATTCAATCTTTTGAATCATCAAAGAAAATACAC
ATACACATAAACTAAAACATATATTACAGTATG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations