Transcript

si:dkey-216e24.3-201

ID
ZDB-TSCRIPT-090929-14954
Name
si:dkey-216e24.3-201
Previous Names
  • si:dkey-216e24.3-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000034049 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000034049|OTTDARG00000025790|ZDB-GENE-070912-438 si:dkey-216e24.3|OTTDARP00000027489 DKEY-216E24.3-002 LG_ BX545856.10 Danio rerio protein_coding NOVEL, 759 bp
TTATTTGACTTGTCTTTACTTAAGGTTTCTCTAATTATTT
AGAATCGCAGTGTTTGTATCTGTGAATTTATAATTTATTC
CATGTTTATAGTTCTTTTTTTATAGTGTTTGTGCATTATT
TGTGGATGCAGGGCTGATTGAGAAACTTCACAAACTCCTC
TGGAACTTCATTGGAGACCTCTGTCTGAACATCAAAGTTC
ATGATGGTGATGCTGAGAAGTCTTCTGCTGCTTTCCTTGT
TTTCCATGGGGAATGCAGCAGCTAGGAGATGCACACGTCA
ATGGAGTAGGTTTGGATCTCGATGCTTTAGATATTTCTCT
GTACCAGTGAACTGGGTCACAGCAGAGAGAAACTGTCAAC
TTCTTGGTGGGAATCTTGTTTCTGTGCAAAATGGTATGGA
AAATGATTTTCTGCTGAGTCTTATACCCAACTCCGAACGT
TTCTTTATTGGTGGCTATGATGGTGAAGATGAAGAAAACT
GGTTTTGGTCTGAAGGATCTTCATTTGGTTATACCAACTG
GTGCTCAGGAGAGCCTAACAACATGAATACGGAGCACTGC
TTGGAGATCAACTGGACATCGGATCGTTGTTGGAATAACT
TGCCTTGTTCAACTGAACAAGGCTATATATGTGCCAAAAA
CCTGGATGGGTGCTCTTAATTTAAGTGTTCATCTTGTTCA
ATCACAAGGCTAAATATGCCAATTAAGATACTCTTCTCAT
CACCTGCTTAAATCAATAAATCAAAGCAAATCATCTGTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations