Transcript

si:dkey-88n24.8-202

ID
ZDB-TSCRIPT-090929-1484
Name
si:dkey-88n24.8-202
Previous Names
  • si:dkey-88n24.8-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000009434 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000009434|OTTDARG00000008260|ZDB-GENE-041014-92 si:dkey-88n24.8|OTTDARP00000008113 DKEY-88N24.8-001 LG_ BX284672.11 Danio rerio protein_coding NOVEL, 1218 bp
TGCTGTGTCTTGCTGAATGACAAATGAGAGCAGATAAACA
CATAGTCTAAAGCTGCAGAACGTAACTTCAGACTGAGGAC
AGAAACACGTCACCTCTGAGAAATGGCTCAAACTTTATAT
TTCACTCTTCTCATTGCTCTCTGCTCCATATCTGAATGTG
TTCAGCGTCAGTATCACTTTATTACTGAGAAGAAGACCTG
GACTGAAGCTCAGAGATACTGCAGAGAGAATTACACAGAT
CTGGCTACCGTTGACAACATGAACGACATGATCCAGCTGG
TAAAGACTGTGAATAATGGAGGTTTTCAGAATATCTGGAT
TGGTCTTATGAGGGCGAGTGTTTATACGTGGCATTGGTCT
TCAGGTGATTCTGTGCTCTTTCTGAACTGGGCATCTGGAC
AACCAGCCGGCAGTGAAAACTGTACTTATATGAGTAATGG
ACAGTGGACTGTCGAGCCATGTAATATGACTTTATCCTTC
ATCTGCTACAACATGAGCACAGGACTGGTGTTTGTCAATC
AGATGATGAACTGGAGAGACGCTCAGAGTTACTGCAGACA
GAATCACACTGATCTGGTCAGTGTGAGGAACCAGAATGAG
AATCAACAGCTGGAGAAGTTCATTCATGACAGAAACTCAT
CTGGATCTGCAGTCTGGATCGGTCTGTTCAGAGACACATG
GCAGTGGTCAGATCAGAGCAACTCCTCATTCAGATACTGG
GATACCATTGAACCAAACAATGATAAAGGTTGTGAAGACT
GCACAGTGATCAATAAGTACGCTCAGAGACGATGGAATGA
CATTCCTTGTGGCTTGACATTTTCTTTTGTGTGTCATGAA
GATAAACTGATAGTGATCCAGCAGAATCTGTCGTGGTCTG
AAGCTCTGAGATACTGCAGACAGAATCATGTGGATCTGGT
CTCGGTTCAGTCAGTGGAGATGCAGCGTCGTGTGATGAAC
GTGGTTAAACTGGCGTCTACTGAGGCGGTGTGGTTGGGTT
TACACCACTACTGCAGCATGAACATGTGGCTCTGGCTGAC
TGGAGACATTGTGTGCTATCAGAACTGGGCTCCAGGGAAC
GGCAGCACACCGGAAAACTGCAAACTGGAGAACAGAAAAG
GAGCAGTTCAGTCTGGAGGAGATCAGACCTGGATCAGCCT
TCCTGAATCTCACAGACTCAACTTCATCTGCACTAACTAC
TGAGAGTGAAAAAGATGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations