Transcript

si:dkey-100n23.3-202

ID
ZDB-TSCRIPT-090929-14764
Name
si:dkey-100n23.3-202
Previous Names
  • si:dkey-100n23.3-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000033829 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000033829|OTTDARG00000025676|ZDB-GENE-070912-345 si:dkey-100n23.3|OTTDARP00000027354 DKEY-100N23.3-003 LG_ BX936337.9 Danio rerio protein_coding NOVEL, 790 bp
AGCAACAACCCCTGAACGCGTTTCAAGAAAAACTGCTGAG
AAAGTAACGGATACAGTAAAAATTGTACTTTCTCTTCACC
ATGGTATGACTTTTGATAAAAGCTGATCCGAAAGAAGGCG
TGGGGTATTTTTCTGCAGAATGCCAGATGAAAGAAAACAT
AACAGTACTTTGTCTGACTCCAGTAATATTACGCCGGAGC
GGAGGAGAGCTCTGATCCTCTCACCGGAGATCAAACGTGA
CAGCCGTCAGACTGAATGCCCTTATAAGATTGCCAGGAGA
GGTTCTGCAGCCGAGGATGAGTGTGTGGAGACAGAGATGT
CTAAAGATCGGAAAAGCAACAATAAGATCCACTGGACACA
GCTGGCCTCAAATGGTACATCCTCCCAGTTATCTCCCAAA
TCAACAAAAAAGAGCAATCAAGAACTTACAATATTGCAGA
AAATCCACAGGAATCAAGTCAAGGTGGTATTAGAAGATGT
CCTTCTTACAGAGCTCGGGCAGAGCTTGCTAAGGTGTAGC
GGGCATACTTTCCAAAAGACAAACCAATCAGAAAGCAAAA
AACGCAGCGATCAAACCTCAACACCCACACTAAAAAACAA
GACAAGAACCAGTCTAACGAAAAGAGGAGAAACAAACTCT
ACTGAACCAAAAGCTACGTCACCATTCCATAATAACATTG
AGTCAAAATCCAAATCACTGAACTCATCACAGAAACTCTT
GGAGTCATCTGAACTATCAAGTAATTCTCGTTCACCCAGA
GAAAGTGAATCACCACAGGCAGCTCTGATT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations