Transcript

uggt2-002

ID
ZDB-TSCRIPT-090929-14744
Name
uggt2-002
Previous Names
  • ugcgl2-002
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000033809 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000033809|OTTDARG00000025667|ZDB-GENE-050517-21 uggt2|no_translation DKEY-46K9.2-002 LG_ BX537139.17 Danio rerio protein_coding NOVEL, 751 bp
TTTTTTTTTTTTTTTAAAGTGATAAGTGTTTTTATTCAGT
AAGGATGGATCTATGTTGCCATAAAAACATTAATAACAAT
ATATGTAAATGTTGCTTTAGTACCAAATAAGCATATTTGA
ATTATTTCTGAAAGATTAATTGACTGAAGACTAGAGCAGC
ACTGCTAAAATATAAAGAAGCATAAGAAACATCTGTTTTA
GTTGTAATATTTAAAAATGTCCACAGTTTTATTTAGAAAT
GCAGTCTTGAGTCGTGGAGACATTGAAAACAAATCTTACA
GACATCATAACAACCATTACAATCAACAAATAGATCACAT
AATTCTGTCATCAAATGTTATTAGCTGTGTTTCTGTTCAT
TGAAGTATATGTTTGGTGTTTTGCAGCTTCTCTGGTGGCC
CGAGTGTGGATGAGGGCAACAATAAGAAAGATGTTCTTAA
CATTTTCTCTGTGGCCTCTGGACATTTATATGAGCGATTC
CTGAGAATAATGATGCTGTCTGTCCTCCGACACACTACAA
CCCCTGTCAAGTTCTGGTTCCTCAAAAACTACCTCTCCCC
CTCTTTCAAGGAAACCATCTCGCACATGGCGAAGGCATAT
GGTTTCCAGTATGAGCTGGTTCAGTATAAATGGCCCCGGT
GGCTTCACCAGCAGACAGAAAAGCAGCGCATCATCTGGGG
CTACAAGATCCTCTTCCTGGATGTGCTCTTCCCCCTTGCC
GTGGACAAGATTATCTTTGTTGATGCTGATC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations