Transcript

trim45-201

ID
ZDB-TSCRIPT-090929-14640
Name
trim45-201
Previous Names
  • trim45-001
  • si:dkey-174k18.7-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000033694 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000033694|OTTDARG00000025601|ZDB-GENE-070912-389 trim45|OTTDARP00000027266 DKEY-174K18.7-001 LG_ CR391919.5 Danio rerio protein_coding NOVEL, 1618 bp
GCCTAAAATCCTTCCCTGCCTGCACACGTTCTGCGCGGAC
TGCGTTCGCCAGCTCGAGCCCTTCTCGGTGCGTCGCGTAA
ACGGGGACCGACGCTCGCCCGGTGAAGACAACTCTGGCTC
TGGCTCCACAATCCTATGTCCCCAGTGTGATTCAGAGGTG
GATCTGCCGCCGTCGGGTGTGGATGGGCTGACCACTGATC
ACCTTGCGCTGGACGAGGTTTTCACGGAGACACTGGTGGT
GAACAACAGTGTATTGTGCGACTTGTGCAGCGACAGCGAC
GCGGGGAAGCGCTGTGAGGTGTGCTGTGTCAATCTCTGCG
ACTTCTGCAGTCAGGCCCACAGGAGACAGAAGAGGACCTC
GTCTCACTCCATCCAGACCCTACAGGAGCTGAAATCTCAG
GGTCGTCTTACAAGGCCCATCCTGTGCTCTCTACATCCTG
GCCAGGAGCTGCGTCTCTTCTGTGAGCCATGCGACCTCAC
CGTGTGCCTGGAGTGTGCTGCCACTTTCCACCGCGAGCAC
CACTGCAGCTCTACTCACGAAGTCATCAGCCGATATGGAG
ATCGCATCAGGGATTTGCTCGTCAGGAGCTTAAAGCCTCG
CCTGGCTCGTCTGGAGGAGTCTTTGAGACGGGTGGATACG
TCCCAAGAAGCGATGCAGGCCCGGACTGATACACTGGCAG
GTGAAATTCGAGCGTTCGCTCGGGCCTATGCTAGCGCAGT
GGAGGCACATTGCTGTTCACTGCTGCGCTCGCTGGACGAC
TTGAGGACGCAGCGCAGGAATCAGCTTCAACTGCAGAAGG
CTCAACTGCAGCAGGCCTTGTCTGATGTGCGCGGTGGGGT
GGAATTCACAGAGCGCCTGCTCATGTGTGGCTCAGATGCC
GAAATCCTCACTGCCAAAGGCGTCACTATGAGGAGACTGG
TAAACCTTGTGGAGTCAGGGTTTGACCCACAGCCATCGAC
GGTTGCCAGTGACAATGCCAGCAGCATTTGTTTTCTTCCT
CAGGAGAGTGCTGGAGAGGTGGAGGGATTTCCTGTGGTAG
GAGCCATACATGCCAAGACTGTGGACCCCAGCAAGTGCAC
TATTCAGGGAGAAGGTGTGGAGCGAGGTTGTGAAGGTCAG
CGGGGCGAGTTCACTCTGGTTTGCAGGGACACTTCTGGAG
AGCAGATGGGCCAGGGTGGAGACCCTGTGATGGTCAGCAT
AGTCCACAGGGAGAAGAAGGGCTGCAGTGTAGAGGCGTCT
GTGGTGGACAACAGCGACGGCTCCTACTGTGTGTCTTACA
GCCCTGCTGAGGCTGGACTTTACTCAGTGTGGGTCTGTGT
TAAAGCACAGCACGTCCAGGGCTCACCATTTGTGCTGAAC
GTGAAGAGGAAGTTGAGACGTCACAGTGGTATCTTCCACT
GCTGCTCCTTTTGCTCCAGTGGGGGCAGTAAAGAGGCTCG
CTGCGGCTGCACAGGGACCATGCCAGGGGGGTTTAAGGGT
TGTGGACACGGTCATAAAGGACACCCCGGTAAGCCGCACT
GGTCGTGTTGTGGGAGTGTAATGGAGGCCTCTGAGTGTGT
TCTCCATAACCTGGGATCTATGTCTCCACGTGGACACCTC
CGCACTGTGGAGCTCTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations