header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-14635
Transcript Name: raph1a-203
Previous Names: raph1a-001, si:ch211-176f1.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000033689 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000033689|OTTDARG00000025598|ZDB-GENE-070912-156 raph1a|OTTDARP00000027264 CH211-176F1.1-001 LG_none CR936378.8,CR753821.6 Danio rerio protein_coding NOVEL, 2010 bp
ATGGAGCAGTTTTCAGATGACGAGCTGGATCATGCTGCGG
AGGAGGACAGCGATAAAGAGGACCAGGACTTGGACAAAAT
GTTTGGAGCGTGGCTTGGAGAGCTGGACAAACTAACAAAG
AGTCTGGATGACGGGAGACCAGAGAAGGTGCAGAAAGCTC
CTCTCAGACAAGATTCAAACATGGCCAACATGGCCTACCG
CTTCTCCGTTTACAACATCAACGAGGCTCTGAACCAGGGG
GACGCAGTGGATCTGGATGCTCTGATGGCGGATCTCTGCT
CTATTGAGCAGGAGCTCAGCACCATCGGCAAACCAAGCAG
CTCTTCCTCTCGCCTTGGCCTGACCGGAGACACAAAGCTC
CGTCAAAAACCCCCAGCGGGCCGCAGTCACAGCACCAAAC
ACACGGGGGGCAGCAGCAGCAGCGGCGGCAGTACCAGCAG
CAGCACCCGTGCTTCACCTGCATCCACCGTCAGACTGAGC
AGCTCCAGCAGTAGTAGCAGACCCCCGCTGGCCTCCAACT
TCTCTCTGGATGACATTACAGCCCAGCTGGAGAAAGCCTC
CCAAAGCATGGATGAAGCAGCCCGACAGGGCTCCACACCC
TCAGCGGCGTACTCTTCCTCCACTGTGCGGCGACCGGCCT
CTCACCATCATCATCATCGCAGGACGGGCTCTGTTGGGAC
GGTTACAGAGCATGAGGTGCGCTCGTTTGTCCATTCCTCT
CGCGCTAGCATTAACTCGGCCTCTGCGTCCAGCATGGACT
CACTGGATATCGATAAACCCTTGTCAGATCAGGATGGTGT
ACAGGACGGACAGGGCCAGCCAAGTACAGAGGTAAACAAT
ATTAAGAACTGTTGTTCTGTTGTATCATTTGACCTTTTTG
ACAGGTCTTATGGTCACTCGTATCTGGACAGGGAGACCTC
TCTCATTCTGAAAAGCATTGCAGGAAAGCCCTCTCACTTG
CTGACCAAGGAGGAACAAGCTGCCAAACAAAAAGCTGAGA
AGATTCGAGTGGCTCTAGAGAAGATCAAGGAAGCGCAGGT
TAAAAAGCTGGTAGTCCGGGTGCATCTATCAGATGAAAGC
TCTAAGACTATGATGGTGGATGAAAGACAGACGGTGCGTC
AGGTGCTGGACAGCCTGCTGGACAAATCTCACTGTGGCTA
CAGTCTGGACTGGTCTCTGGTAGAGATCATCACTGAACTC
CAGATGGAGAGAATCTTTGAGGATCATGAGAATCTGGTGG
AGAACTTGTTGAATTGGACGAGGGACAGCACCAACAGACT
GATGTTTATTGAACGAATTGAGAAATATGCACTCTTCAAG
AATCCTCAGAACTATTTGCTGGGGCGTAAGGAGACGTGTG
AGATGGCGGATAGAAATAAAGAGGCTCTGCTGGAGGAGTG
TTTTGGTGGGAGCACTATCAGCGTGCCTGAGATAGAAGGG
GTGCTCTGGCTCAAAGACGATGGCAAGAAATCCTGGAAAA
AACGCTACTTCTTGTTACGAGCCTCCGGGATTTATTATGT
GCCAAAGGGTAAAGCCAAGGCCTCCAGAGACCTGGTTTGC
TTTCTGCAGCTGGATCATGTTAATGTGTACTTGGGTCAGG
ACTACCGCAGCAAATACAAAGCCCCGACTGACTACTGCAT
GGTCTTGAAGCACCCTCAGATTCAGAAGAAATCACAGTAC
ATCAAGTATCTGTGTTGTGATGATGTCAGAATGCTGCATC
AGTGGGTCAACGGAATACGCATTGCCAAGTATGGGAAGCA
GTTGTATGTTAACTACCAGGAAGCTATGAGGCGCACAGAG
GCTGCACATGATTGGTCCTCTCTGTCCAGCTCCAGTATTA
AGTCTTGTTCCAGTTCCTCAAGTCTACCAGAATCTCAGTC
TAACCACTCCAGCCAGTCAGACAGTGGTGTGTCAGAGACC
ACGTCCTCTGGTCATGTGCGCTCTCAGAGTGTGGTCAGCT
CCATCTTCTCCGAGGCCTGGAAGAGAGGCAATCAAGCAGA
TGAACCCAAG

raph1a TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA raph1a-203 2010
ncRNA raph1a-002 (1) 774
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
raph1a-203 Contained in:

Genome Resources: Vega_Trans:OTTDART00000033689 (1),  Ensembl_Trans:ENSDART00000146597 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:AL917861 (1) 539 bp
GenBank:CR929451 (1) 539 bp
CITATIONS (2)