Transcript

raph1a-203

ID
ZDB-TSCRIPT-090929-14635
Name
raph1a-203
Previous Names
  • raph1a-001
  • si:ch211-176f1.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000033689 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000033689|OTTDARG00000025598|ZDB-GENE-070912-156 raph1a|OTTDARP00000027264 CH211-176F1.1-001 LG_none CR936378.8,CR753821.6 Danio rerio protein_coding NOVEL, 2010 bp
ATGGAGCAGTTTTCAGATGACGAGCTGGATCATGCTGCGG
AGGAGGACAGCGATAAAGAGGACCAGGACTTGGACAAAAT
GTTTGGAGCGTGGCTTGGAGAGCTGGACAAACTAACAAAG
AGTCTGGATGACGGGAGACCAGAGAAGGTGCAGAAAGCTC
CTCTCAGACAAGATTCAAACATGGCCAACATGGCCTACCG
CTTCTCCGTTTACAACATCAACGAGGCTCTGAACCAGGGG
GACGCAGTGGATCTGGATGCTCTGATGGCGGATCTCTGCT
CTATTGAGCAGGAGCTCAGCACCATCGGCAAACCAAGCAG
CTCTTCCTCTCGCCTTGGCCTGACCGGAGACACAAAGCTC
CGTCAAAAACCCCCAGCGGGCCGCAGTCACAGCACCAAAC
ACACGGGGGGCAGCAGCAGCAGCGGCGGCAGTACCAGCAG
CAGCACCCGTGCTTCACCTGCATCCACCGTCAGACTGAGC
AGCTCCAGCAGTAGTAGCAGACCCCCGCTGGCCTCCAACT
TCTCTCTGGATGACATTACAGCCCAGCTGGAGAAAGCCTC
CCAAAGCATGGATGAAGCAGCCCGACAGGGCTCCACACCC
TCAGCGGCGTACTCTTCCTCCACTGTGCGGCGACCGGCCT
CTCACCATCATCATCATCGCAGGACGGGCTCTGTTGGGAC
GGTTACAGAGCATGAGGTGCGCTCGTTTGTCCATTCCTCT
CGCGCTAGCATTAACTCGGCCTCTGCGTCCAGCATGGACT
CACTGGATATCGATAAACCCTTGTCAGATCAGGATGGTGT
ACAGGACGGACAGGGCCAGCCAAGTACAGAGGTAAACAAT
ATTAAGAACTGTTGTTCTGTTGTATCATTTGACCTTTTTG
ACAGGTCTTATGGTCACTCGTATCTGGACAGGGAGACCTC
TCTCATTCTGAAAAGCATTGCAGGAAAGCCCTCTCACTTG
CTGACCAAGGAGGAACAAGCTGCCAAACAAAAAGCTGAGA
AGATTCGAGTGGCTCTAGAGAAGATCAAGGAAGCGCAGGT
TAAAAAGCTGGTAGTCCGGGTGCATCTATCAGATGAAAGC
TCTAAGACTATGATGGTGGATGAAAGACAGACGGTGCGTC
AGGTGCTGGACAGCCTGCTGGACAAATCTCACTGTGGCTA
CAGTCTGGACTGGTCTCTGGTAGAGATCATCACTGAACTC
CAGATGGAGAGAATCTTTGAGGATCATGAGAATCTGGTGG
AGAACTTGTTGAATTGGACGAGGGACAGCACCAACAGACT
GATGTTTATTGAACGAATTGAGAAATATGCACTCTTCAAG
AATCCTCAGAACTATTTGCTGGGGCGTAAGGAGACGTGTG
AGATGGCGGATAGAAATAAAGAGGCTCTGCTGGAGGAGTG
TTTTGGTGGGAGCACTATCAGCGTGCCTGAGATAGAAGGG
GTGCTCTGGCTCAAAGACGATGGCAAGAAATCCTGGAAAA
AACGCTACTTCTTGTTACGAGCCTCCGGGATTTATTATGT
GCCAAAGGGTAAAGCCAAGGCCTCCAGAGACCTGGTTTGC
TTTCTGCAGCTGGATCATGTTAATGTGTACTTGGGTCAGG
ACTACCGCAGCAAATACAAAGCCCCGACTGACTACTGCAT
GGTCTTGAAGCACCCTCAGATTCAGAAGAAATCACAGTAC
ATCAAGTATCTGTGTTGTGATGATGTCAGAATGCTGCATC
AGTGGGTCAACGGAATACGCATTGCCAAGTATGGGAAGCA
GTTGTATGTTAACTACCAGGAAGCTATGAGGCGCACAGAG
GCTGCACATGATTGGTCCTCTCTGTCCAGCTCCAGTATTA
AGTCTTGTTCCAGTTCCTCAAGTCTACCAGAATCTCAGTC
TAACCACTCCAGCCAGTCAGACAGTGGTGTGTCAGAGACC
ACGTCCTCTGGTCATGTGCGCTCTCAGAGTGTGGTCAGCT
CCATCTTCTCCGAGGCCTGGAAGAGAGGCAATCAAGCAGA
TGAACCCAAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations