ZFIN ID: ZDB-TSCRIPT-090929-14595
Transcript Name: si:ch211-167j6.5-202
Previous Name: si:ch211-167j6.5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000033645 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000033645|OTTDARG00000025574|ZDB-GENE-070912-147 si:ch211-167j6.5|OTTDARP00000027237 CH211-167J6.5-001 LG_ CR752651.14 Danio rerio protein_coding NOVEL, 645 bp
CCAGAGGGTTTCCATTAAGAGAGGGAGACATACTGAGTCC
AGGATCCCGCAGTGCCATTACCTGTCTAGGAGATTCCTGC
CGCTGGCCCAAAGCTGTGGACGGATTTGTGTATGTACCAT
ACATCATGTCCACATTATATGATGATATGGACAGAATCAC
GATAGAAACAGGGATGTTGGACATTTCCTCGTCAACCTGT
GTAAAGTTTGTCCCTCGCACACATCAAGCAAACTTCCTCA
ATATTCAGCCTAGATATGGCTGCTGGTCATATCTGGGAAT
GACAGGAGGCAGTCAGACGGTCTCTCTGCAGTCTCCAGGC
TGCATGTGGTCAGGAGTGGCGTCCCATGAGCTCATGCACG
CTCTTGGTTTTGTACACGAACAGTCCCGCTCTGACCGTGA
CCGCTACGTTTCCATCCTATGGGAAAACATCATAGAGAAT
CAAAGACACAACTTTAGAAAGTATGAGACCAACAACCTCA
ATACCGCATATGACTACAGTTCTGTCATGCACTACGGGAG
GTATGCCTTCTCAGAGGATGGGGGGCCCACCATCATTCCT
AAACCAGACCCTTACATTCCCATTGGCCAGAGAGACGGAC
CAAGTATTCTGGACATTCACAAAATAAACATCTTGTATAA
CTGTG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-167j6.5-202 Contained in:
[BAC] CH211-167J6 (1)

Genome Resources: Vega_Trans:OTTDART00000033645 (1),  Ensembl_Trans:ENSDART00000136417 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)