ZFIN ID: ZDB-TSCRIPT-090929-1449
Transcript Name: wnt7ba-001
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000009272 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000009272|OTTDARG00000008139|ZDB-GENE-041210-178 wnt7ba|OTTDARP00000007995 CH211-239E6.2-001 LG_ BX649425.3 Danio rerio protein_coding NOVEL, 1016 bp
CAGCTGCTTACATCAGTGTGTCTGGTCTCCTCCAAAGGGC
TTTGTCTTCAGTCGTGGCTTTGGGCGCAAACATCATCTGC
AACAAGATCCCCGGCCTGGCCCCCCGACAGCGTGCCATCT
GCCAGAGCCGCCCAGATGCCATCATCATCATTGGGGAAGG
CGCTCAGCTGGGCATCAACGAGTGCCAGTATCAGTTTCGC
TACGGCCGGTGGAACTGCTCTGCCCTTGGCGAGAGGACCG
TCTTTGGGCAAGAGCTGAGAGTAGGTAGCAAGGAGGCTGC
ATTTACCTACGCCATCACTGCAGCAGGAGTTGCCCATGCA
GTGACTGCAGCCTGCAGTCAGGGCAACCTGAGCCACTGCG
GCTGCGACAGAGAAAAACAGGGCTACCATGACCAGGAAGA
GGGCTGGAAATGGGGCGGCTGCTCGGCGGACGTCAAATAT
GGAGTGGAGTTCTCCAGACGCTTCGTGGATGCACGAGAGA
TAAAAAAAAACGCAAGGAGGCTAATGAACCTGCATAATAA
TGAAGCAGGAAGAAAGGTTCTAGAAGAAAGGATGAAGCTG
GAATGTAAATGTCATGGTGTCTCTGGCTCATGCACCACCA
AAACCTGCTGGACAACTTTGCCAAAATTCCGAGAGATCGG
CTACGTGCTGAAGGAGCGTTACACCACCGCGCTTGAGGTG
GAGGCTGTGAGAGCCACCCGTTTTCGACAGCCCTCCTTCC
TACGTCTCAAGCAGTCTCGAGGGTACATCAAGCCCACAGA
CACAGACTTGGTGTTCTTAGAGCGCTCCCCCAATTACTGC
GAAGAGGACACTGTGACGGGGAGCGCAGGAACGAGAGGAC
GCCTATGTAACCACACGTCTCCTCTCACAGATGGTTGCAA
CCTGATGTGCTGCGGCCGAGGACACAACACTCATCAGTAC
ACACGCGTGTGGCAGTGCAACTGCAAGTTCCAGTGGTGCT
GCTTTGTGAAGTGTAACACCTGCAGCGAAAAGACAGAGGT
GTTCACTTGTAAATGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
wnt7ba-001 Contained in:
OTHER wnt7ba-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000009272 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCESNo data available
    CITATIONS (1)