header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-14477
Transcript Name: si:dkeyp-118h3.6-201
Previous Names: im:6907446-001, si:dkeyp-118h3.6-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000033527 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000033527|OTTDARG00000025483|ZDB-GENE-050809-8 si:dkeyp-118h3.6|OTTDARP00000027127 DKEYP-118H3.6-001 LG_ BX842683.9 Danio rerio protein_coding NOVEL, 1434 bp
ACATGAACGCAAAACAAGAGCTCATCTTCCGGCGCCATCC
GGAAATGGACTGAGAAACATGGCGTCGCACAGGACAGACA
GAACGAAAAACCCCACATCAAATGGAGATGTTTCCAAAGT
CGACCTTCTGCTTCATCCAGAGCTTCTTTCTCAAGAGTTC
ATTCAGCTCATGTTACAAGAGAGGAATATAGCAGTGTCTG
ATCCTGAGGACCGGGACCGGCTCACAGGCCTGTACCTGCA
GCATGTGATTCCTCTCCCGCAGAGAGAACTGCCACGCAGC
CGCTGGGGGAAGAGGATGGAGAAGAGCAGACCACGCCTAA
GCTCCAGCAGCACACACAGTTCCAGCACTGATAGTGGCAG
GAAGAGGCCGTTGATAGTGTTTGACGGCAGCTCTACTAGC
ACTGGCTGTGTTAAGCTGAAGAAACCGGACTCTTCATCGG
CACCTGTCACCACAGACAGACTTAAGCCCCCGGTTTCCAG
TGTCAGTCTCACAAACCCCATACGCAAGCTCTCTGGGGCA
TCCACAAACTGCTCTTCCTCAAACTTCTCTAACAGGACCC
CAGTTTCATCGTCAGGTGCCATTCCCAAGAGCCCCTCTAA
CCACTCCAACTCCTCCGTGCATTCAAACAATGCCACGTCT
AAGCTAAAGCGCACGTCCCCCAGCAAAGGAGAACCAGACA
CTGCTAAGGACATAAAGTCACCTGAAACAAAGAAAAAGAT
TCAACATATCACATGGCCGTAATGTCCGGTGTCTTCTAGG
ATGGATGTTTTAATACCACTGACTGGGTCCGCCTGTTGGC
CAAGAGACGCACGTGAATTGGAAAGATAGGTTCTTTTCAA
ACACCTCAAGTTGTCACTTTCACCTTTACTTACCAACCTC
AGGAAAAGTGACGTGTGATCCTCCAGTTTATTTTACTGTA
GGAGACGCTTCTACTTTGGGCTTGTAGTGTTGAAAGAACT
AAGACATTCCTAGCAGTTTTATGTTGGACTTATACAATTT
TCACTTTTTAGCAATTAATTTAGAGAACTTTGTTCCTTAG
TTAATCATGTTAAAGGAATTAGATGACATACTGACATGCT
TTTTGGTCTGTCAGAGATGTGTTTTACTGGCATAGTAACT
GGATTTGCATTTATTGAGTGGTGTTTTGAAGAACTCCTTT
AAAAGGCATTCTGTGATTTAGATCTGAGATGGCCTATCTA
AGTGGTTTGACCAATATCAAGTAAAAACCCTTGACATTTT
TGTGTTTATAGCCCCATGTGGCCTTAATGCAATTCTGGTG
TGTGTTGCATTATGCATTGGTAAATGAGGGTTGTTTCACT
TGTCAGTGTATTAGTTCGGGTGTTTTCGAGACATGAATTT
AGTTTTTATTCAGTGCACCTTATTGCATGGAATGCTCCAC
GGTGACTAAAAAATAAAAGGCTGAGAGCATTTAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkeyp-118h3.6-201 Contained in:
[BAC] DKEYP-118H3 (1)

Genome Resources: Vega_Trans:OTTDART00000033527 (1),  Ensembl_Trans:ENSDART00000061585 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC109457 (1) 1445 bp
GenBank:BC093350 (1) 1437 bp
GenBank:CN176182 (1) 806 bp
CITATIONS (2)