Transcript

uhrf1bp1l-202

ID
ZDB-TSCRIPT-090929-1444
Name
uhrf1bp1l-202
Previous Names
  • uhrf1bp1l-001
  • si:dkeyp-90a8.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000009267 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000009267|OTTDARG00000008135|ZDB-GENE-041210-177 uhrf1bp1l|OTTDARP00000007991 DKEYP-90A8.1-001 LG_none BX901882.34,BX649503.3 Danio rerio protein_coding NOVEL, 4704 bp
GTGAAGCGGTAGCAGCGGACGCCTCAGCCAGTCATGTTTA
TATTTTGCATTTATGAAGCTTTCCAGTCCACAAGAAAACA
CTCTGGCTGACCGGAGGAATACCTAAAATGTACAGCTTCC
AATATCTGCCGGTCGTCCTTTGATAAGTGATTAAAGAGAT
ACCGGTCATGGCTGGATTGATCAAGAAACAGATCCTGAAA
CATCTCTCCAGGTTTGCTAAGAACCTGTCTCCAGATAAGA
TTAATCTGAGCACTCTGAAAGGGGAGGGCCAGCTTACCAA
CCTGGAGCTGGATGAGGAGGTGCTGCAGAACATGCTGGAT
CTGCCCACCTGGCTCGCCATTAATAAAGTCTTCTGCAATA
AAGCCGCCATCCGGATACCATGGACCAAGCTAAAGACTCA
TCCAATCTCTCTGTCTCTGGATAAAGTTGTCATGGAGATG
AGCACCTGTGATGAGCCCCGCCCTCCCAACGGCCCATCAC
CCATAGCAACAGCCTCGGGTCAAAGTGAATATGGTTTTGC
AGAAAAAGTGGTGGAGGGCATCTCTCTCTCTGTGAACTCC
ATAGTGATTCGCATCAGCGCCAAAGCCTTTAATGCATCCT
TCGAGCTCTCACAGCTTCAGGTTTACAGCGTCAACACCAG
CTGGACCACTGGTGACCTCCGATACACAAGAATCCTGGAC
CCCACACGAGGAGAGTTGCTAACGTTTAAGGAAGTGAGCT
GGCAGATGATCAGGATTGAAGCAGACGCCATCCAGAACAC
CGAACATGAGGTCGTCAGTGCCCCAATCCGCCTCATCACC
AACCAATCGAAGATCAGAGTCACTTTAAAAAGAAGGATGA
AGGACTGTAATGTGATTGCATCAAAGCTGACTCTGATCCT
GGATGACCTGCTCTGGGTGCTGACGGACTCTCAGCTCAAG
GCCATGGTGCAGTACGCTAAGTCTCTTAGTGAATCCATGG
AGAAATCCGCTTCGCAAAGGAAGAGCATGGCCCCTGACAC
TACACAGGTGACACCGGCACCCCCCACAGCCCAGCAGATG
CGCACGCAGCAGGCTTCAGCCGCGGCAGATCAGACCGCTT
CCATGGCACGGCTCTTCACCGCCTATGATGTTCGTGAGAC
GTCACACCACCTCCAGATCACACACTTGGACCTGCATATC
TGCGATGACACCAATGCCAAGGATAGAGGAATTAATAAGA
GATTGGATGGTGGTGCAATGCAATTGTCTTTTAGTTCTAT
CAGCGTAGACTATTACCCTTTCCACAAAGCTGGTGAGGGC
TGTTTGCATTGGATGCACTATGGCGAAGCAACAAAATCTC
GTGAAACCTGGGCGCGTTCTCTCCTGGACGAGTTTAAGTC
TAATGTCGATATGCTGAAAAACGCAGTCAGCGGACAGTCC
CAGGGCTCTCCTCAGCACGGAAAGATCTCCACCAGCTCCA
GCACTTCCTTCTCACCCCCTACTCCACCGAGAACCCAACT
TATGTCCAGCTCAATAGTGCTGCGGATGGCAGACTTTAGC
ATCTATCAGGTGTCTTCAGCAGACCAGCCACGCTCTAGTC
CTCAAACCATGATATCCTGCAATAAGAAATCCCTCTATCT
CCCCCAAGAGATGCCGGCTATTCACGCCGAATTCACAGAG
TACTACTTCCCAGATGGCAAGGACTATCCAGTCCCTTGTC
CCAACCTCTATGTGCAGTTGAACGCACTACAACTGGTGCT
TGACTCGAGAAGTCTGGTTTGGCTTAATCTGTTCGCACTG
GACCTTCGGCAGAGTTTGGAGCAATTCATGGATCTGTACA
AACTCAATGACTCACAGAAGCCTGAAGAACATGTAGATAT
CAAAGTGGATGGACTCATGCTTAAGCTGGTGATCCCTGCA
GACCACGAGAAAACTCAACCTGACCAGCCCCGTTCTGTGT
CAGTTCAGACCTCAGAGATGGTAGCCACTAACACGCGTCA
CTCTTCAGCATGCTCGCGATCAAGTCTGGAAGCCCTCTTG
CAGGCCTTCCAGGAGCAACCCTTCTTCACCTCCCTCTCTT
CCACCTTCCCTCGAGCCCCAAGTTCCTTCTCTGTGCTCCA
TTCTGTCTTCCAGCGGCACGCTCATGAACAGGACACGCGC
GTTCATGATGTGTACCGCGGCCTCGCTCCACCATCTCTCT
CCACCAATGCCCTCAAAACACCAGCAGCCACCGACCTGTG
GGCCATGCATTTCTCTCAGTTCTGGGTGGACTATGAGGGG
TCCCGCAGTGGCCGAGGTCGTCCCACACCTTGTGTGGACT
CCTTTCCTCTGACACTTTGGGTATGCCACCCTGCCCGATA
CACGCAGCACCTTGAGCGACTCAGAGTAGGGTCAGGACTG
TTGCCTCGCAGTGAATCAGCAGAGATGGCCAATCGTCTGC
AGAGGAAGAAGCTTCTTAAAGAGTACTACAGCACTAATGC
ATCTCCCAGCGACACACCAAGCAATGGCCTCCACAAACCA
CAGTCTCTAGATGGCCTATTCAGTGACTCCTCTTCATCTC
TTCCCCTTGCTTGCTCAGCAAATGAAGTAGATGTGCAGGT
GCTAGTGCATGTTCAGAAACACCTGAGCGCTCAGGTGAGC
CACGGGCAGTATGTGTTCCTGCTCAGGCTGCAACATGCTG
TGAAAACTCTGCAGCGCACTATTCAGCAAGATCTGGAGCA
GTACGGCTCCAAGCGCTTGGGTCCTACACAACCCTTTAGT
GCCTGTGTGGGTGTGCTTATGAAAAGTGCAGAAGTTGCTC
TTCTCCTAAAGCCTATTCCCCAACCAGATTTAAGCACCAG
CCCCTTGAACTCTGATGTCTCGCCTTCAGAAAGCAGAGCC
ACTCTTGAAGCTGGGAGTGAGGTGAGCGAGGGACATGAGA
GACCCTCGGCTGCAGGAGAGGGTACTCGAAATGTGGATCA
GCTCCTCTGTGCAGATAGAAATTCCATCGACACATCTCCG
CTCCTTCCTTCCTCATCTTCTGCTCTGAGAAAAACATCTA
TGGATGAGAGGAGTAGCGTGGCTTCTGGAGGGAGGGTGCC
ATCCGAGGAGAAGAAGGACTTGAGGGAAGGATCCCCCGAT
GGGGATACTAGCAGATCTGAAGCCAAAGGACAGCAGAATG
AAACCTCTCAAAGTGGAATGGCTGTGGTAGATCCCATCTC
TGACACTTCTTCAAGGGAATGGAATGACAAGAGTCAGGGA
GCCAGATTGCCTCAGTCCATGTCCAGGTATTGCGTTGTTT
GTGCATATAGAACACAACTGCCAATTCCTTCCTCCTGGTT
TTTATTTTATTTATTTACAAATTTGCATGGTCGTTTGATG
CAGGGCAAGTCGCAGTCAAGTTTCTCAGTGTCCTATAAGA
ATATGAAGAAAAGTCCTTCACTACAGTCTTTGGATGATCT
CTCCATGGACAGCTATCTACTAGAGGACTGTGACAGCTAC
AGCCTGCTGGACAGAGATGATGTATCGATCTCTGGTTTTA
AGGAGGCATTGAATGAACGTATTTCCACAGACGGCTCTGT
GACTCTTGCTCAGGAGGCAGATGAAGCTCAGTCACCTGAC
GCCATCAGCGCTGCCTCTCAGAGCATAGACGAACCCATGA
AAGACCTTGTGTCGGTGCTGGTTATGAAGGTTTACTCAGT
CTGCTGTTCTCTGGATCTAAAGGGCGATGATACAGCTGTA
GCTCTGGAAGTGGGACGGGTTCAACCCAATCAGCTCGGAA
ATGTCAGTTTGCGGCAGTATCTTAGCAACCGGAGCCTGGG
TTCCGGGTCAGGGTCAGACCCCAGTGCAGTGTTGTTGAAT
CCCGAGGTGCAGGTGAGGCTGGAGAGCGGTCCGAGTGCTG
CTGTTCACTCTCCTCTTGCTGAACAGAACGGTTTTCTGCA
GTGCCGCCTGCAGGCCTTCAACACTGACTTCCTGATAACA
TCACTACGAAACCTTGCCCTCTTCCTGGAGGATGACTCCG
CCTCTCAGGTTCTGCCAATGGAGATTACCATCAAAGACAC
ACACGTCAACCTGAAGGATGATGGTCCTCGTGACAACATC
TCCGAGCCGGAGCCCTCACCCATCTCTGTGCACATTCATA
ATCTGCTCATCCATCGACAAGACGACGGCTCATTCAGCAT
CGGAGGAGCTGAACGCGCTGTGGACTCCCAGCTTCAGACG
GCGGGGCCTGTGAATGACAGCAGGCTCAGTTCTGTCCCTG
AGGTCCCCGTAGGTGTGAAAGCCACTCAGACTGCACCTCT
GTCACCCACAAGCCCCGGCCCCTCGAGTAGAGAACAGCTG
CTCGTGGAGGAGAATGAATGCTTGAAGCTGGAGCTCTCCA
AAGCCAAGATGGCGTTAGCAGAAGCGCAGATGGAGAAAGA
CTCTCTCCAGCATCAAATGAAGACGCTTAAACTCACCAGC
GGGGGCAGCAATAGCTAGTGTGTGTATGTGTTTGTGAGTG
TGTGTTCAAACAGGACAGACACTCGCCACAGGGGAGCAGC
AGAGGGCTTGAAGGGGCCCGGAGCCATAGCAAATCCCAAA
TCTGCAGCAGAGAAGATGATAGTGTGTGTGTGTGTGTGTG
TGATGGAGATCCAGAGCAAATCAAAGAATAGTGTTTTTTT
TATTGTAATGTACACACAATCAGATCATGTGTTGCAAAAA
AAAAAAAAAAAACTCTTCGGAGCCTGTGGAGCTTCACATA
CTTTTTTTTTTTTGCTTTTATTAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations