header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-14340
Transcript Name: rfwd2-003
Previous Name: zgc:163067-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000033342 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000033342|OTTDARG00000024934|ZDB-GENE-070410-134 rfwd2|no_translation DKEY-39F8.2-003 LG_ CR388403.8 Danio rerio protein_coding KNOWN, 540 bp
GCAGCTCGGGTAACGGGGTGTCCTCGAGGACTCTGGGCTC
GGTAGCCGACGGACAGAGCGCTCGTCTGGGCTCTTTAAGC
AGGAAAAGACCCTTGTATAACGGTCTTATCAATCCCTATG
AAGACAAGAGTAATGATTTTGTATGCCCTATATGTTTTGA
GATGATAGAGGAAGCTCACATGACAAAGTGTGGCCACAGT
TTCTGTTATAAATGTATACGACAGAGTTTGGAGGACAGCA
ACAGATGCCCAAAATGTAATTACATAATTGACAATGTGGA
TCAACTTTACCCCAACTTCTTAGTGAATGAACTAATCTTG
AAACAAAAACAGAGATCTGAGGAGAAGCGTCTAAAACGGG
ATCACCCTAATGGAACCAAATGGCAAGTTTTCCAGGATGT
TCTTGGGGCTGATCAAGAGAATATGGATTTAGCAAATGTC
AACTACATATTAGAGTACCTGCTGCAAAAAAAGAAACAAC
TGGAGGCGGTTGGTATACGTTTTAAATATATTACATTATT
GTAACACTTCAGGGTTCCTT

cop1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA cop1-201 (1)    Ensembl 2617
ncRNA rfwd2-003 540
rfwd2-004 (1)    Ensembl 710
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rfwd2-003 Contained in:

Genome Resources: Vega_Trans:OTTDART00000033342 (1),  Ensembl_Trans:ENSDART00000140544 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:AL925436 (1) 539 bp
CITATIONS (2)