Transcript

rfwd2-003

ID
ZDB-TSCRIPT-090929-14340
Name
rfwd2-003
Previous Names
  • zgc:163067-003
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000033342 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000033342|OTTDARG00000024934|ZDB-GENE-070410-134 rfwd2|no_translation DKEY-39F8.2-003 LG_ CR388403.8 Danio rerio protein_coding KNOWN, 540 bp
GCAGCTCGGGTAACGGGGTGTCCTCGAGGACTCTGGGCTC
GGTAGCCGACGGACAGAGCGCTCGTCTGGGCTCTTTAAGC
AGGAAAAGACCCTTGTATAACGGTCTTATCAATCCCTATG
AAGACAAGAGTAATGATTTTGTATGCCCTATATGTTTTGA
GATGATAGAGGAAGCTCACATGACAAAGTGTGGCCACAGT
TTCTGTTATAAATGTATACGACAGAGTTTGGAGGACAGCA
ACAGATGCCCAAAATGTAATTACATAATTGACAATGTGGA
TCAACTTTACCCCAACTTCTTAGTGAATGAACTAATCTTG
AAACAAAAACAGAGATCTGAGGAGAAGCGTCTAAAACGGG
ATCACCCTAATGGAACCAAATGGCAAGTTTTCCAGGATGT
TCTTGGGGCTGATCAAGAGAATATGGATTTAGCAAATGTC
AACTACATATTAGAGTACCTGCTGCAAAAAAAGAAACAAC
TGGAGGCGGTTGGTATACGTTTTAAATATATTACATTATT
GTAACACTTCAGGGTTCCTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations