ZFIN ID: ZDB-TSCRIPT-090929-14230
Transcript Name: dip2cb-202
Previous Names: dip2cb-001, si:dkey-7l6.7-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000033096 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000033096|OTTDARG00000025150|ZDB-GENE-070912-589 dip2cb|OTTDARP00000026768 DKEY-7L6.7-001 LG_none BX005044.9,BX927382.9 Danio rerio protein_coding NOVEL, 4491 bp
AACGGCGCATCCCCGTAACACCATCTTCATCGTCTTCCTC
ATCCTCACGTTATCAACGCAGACGGTCCACTGGGTCAAGG
GATGAACGTTACCGCTCAGATGTTCACTCAGAAGCGGTTC
AGGCTGCGTTGGAGCGACACAGTGAGAGAAAGATGGCTGT
GCTTTTGCCATCCAAGCGGCGCTCGCTCATTGGTCAAACC
TCCATGGACACATACACTCCTCCAGACTCGTCCTCCGGCT
CTGACGCTGAGGGGTCTCTGGGGAGAGCAGGGGGTGTCAG
TGTGGACTCGTGGATCAGCAGAGCTCTCCACGGCTCTCCC
TCAACATCATCGTCATCATCGTCGCACAGCAACAGCTCTG
CCAACGCAGCCCGACTGGCAGAGACCAGCATGCACACATA
CGCCAACAGTCTGTCGGCTCCTCCTGACATCACTAGCTAC
ATGCCAGACTCCGCCCCCATTTTGGTTCATCGTCCACAAA
TCGCCATGATTACCAGACCCCCGCCCAAATATGGTAATGC
TGAGCTGATGGAGACAGGAGATGGTGTTCCTGTCAGTAGC
CGTGTGTCAGCAAAGATCCAGCAGCTAGTTAATACACTAA
AACGACCAAAGCGAAGACCTCTAAGAGAATTCTTTGTGGA
GGATTTTGAAGAACTTCTGGAAGTGCAGCAGCCTGATCCG
TCTCTGCCACGCCCAGAAGGGGCGGAGTCAATCCCCATAG
AAGGAGAGGAGTTGGACAGACTGAAAAATTGCCCCGCCTC
CCTGGAAGCGGCTCTCCTGCGCTGGGGAGCCATTGCACCC
AAAGCCCCCTGCCTGACCACTACACACAGCAATGCCAAAC
AACCGTACACACTTACATATGGTAAGCTTTGGTCCAGGAG
TTTGAAGTTGGCCTATAACCTCCTCCATAAACTGGGATCC
AAACAAGAGCCAATTATCCATCCTGGAGACCGGGTAGCAT
TGGTTTATCCTAATAGTGACCCAGCAGCGTTCATGGTGGC
GTTTTATGGCTGCCTTTTGGCTGAAGTTGTTCCTGTTCCA
ATTGAAGTACCACTTACAAAGAAGGATGCTGGGAGTCAAC
AGATTGGGTTTCTGTTGGGTAGCTGTGGTGTAACTGTGGC
GTTAGCCAGCGATGCGTGTCATAAAGGTCTTCCTAAGAGT
GCTAGTGGTGACGTCATGCAGTTTAAAGGTTGGCCAAAGT
TGCTCTGGGTGCTGACTGACTCTAAACATTTATCTAAACC
CCCTCGGGAGTGGTTTCCTCTAATTAAAGATGCCAACAAT
GACACCGCATACATAGAGTATAAGACCTGTAAGGATGGCA
GTGTGATGGGGATAACCGTGACAAGGATGGCGATGCTCTC
ACACTGCCAAACTCTTACACACACCTGTGGATACAGTGAA
GCTGAGACTGTGGTGAACGTGTTGGACTTTAAAAAAGGCA
TTGGCCTTTGGCACAGTGTTCAAACGAGTGTATTGAATAT
GTTACATGTGGTCAGTGTTCCCTATGCACTTATGAAGGTG
AATCCTCTGTCCTGGATCCAAAAAGTCTGCCAGTACAAAG
CTAAAGTGGCGTGTGTGAAGAGCAGGGATCTACACTGGGC
TCTGATGGCCCACAAAGAGCAGCCGGACACCAACATGAGC
TCATTGAGAATGCTGCTCATCGCTGATGGGTCGAACCCCT
GGTCGATATCCTCCTGCGACGCGTTCCTGAACGTGTTTCA
GAACATGGGCTTGAGGTCAGAGGTCATATGCCCATGTGCT
GGTTCCCCCGAGGCTCTAACCGTCGCTCTGAGGAGGCCTC
AGGAGAGCAGCTCAAAGCCTGCAGGCCGAGGGGTCCTGAG
TATGACCAACTTGAGCCACGGGGTGATTCGGGTGGACACA
GGAGAGAAGCTGTCCGTCCTCACCCTGCAGGACGTGGGCA
CAGCCATGCCAGGAGCGGTGGTGTGTGTCGTTAAAGTGGA
GGGCGTTCCTCAACTGTGTAAAGCTGATGAGATAGGAGAG
ATCTGCGTGTCGGCTGTTGCAACGGGCACGTCCTATTATG
GGCTAACCGGAATGAGCAAAAACACATTTGAGGTTTGTCC
AGTGGCGTGTGACGGTGGATTGGTCAGTGACTGTGTGTTC
GTGCGGTCGGGTCTGCTGGGGTTTGTGGGTCCAGGCAGGA
TGATCTTCATCTCTGGGACACTTGAGGGACTGATGCAGGT
CGGCGGACGGAAACACAACGCTGATGACATCATTGCTACC
GCTCTGGCTGTGGAGCCCATGAAGTTCATCTACAGAGGAA
GGACGGTGGTGTTTTCAGTGACTGTACTGTATGATGAGAG
GATCGTGCTGGTGGCAGAACAGAGACCAGATTCCACTGAA
GAAGAGAGTTATCAGTGGATGAGCCGAGTGCTGCAGGCTA
TAGATGGAATTCATCAGGTTGGGGTCTACTGTCTGGCACT
GGTTCCTGCTAACACTCTTCCCAAAACCCCTTTGGGAGGA
ATCCACCTGTCTGAGACAAAGCAGCTGTTCCTGGAGGGGG
GTCTTCACCCCTGCAGCATCCTCATGTGTCCTCACTCCTG
CATCACCAACCTGCCCAAACCCAGACAAAAACAGCCTGAG
GTGGGTCCTGCCTCAGTGATGGTGGGGAATCTTGTCGCGG
GGAAACGAATGGCTCAGGCCAGCGGACGAGATTTGAGTCA
CATGGAGGACAATGAGCAGTTTCTCTTTCTGTCGGAGATG
CTGCAGTGGAGAGCTCAGACAACACCAGAGCACATACTGT
ACACGCTCATTAACTCACGGGGAGCAGTAGGAAGTTCTCT
GACTTGTCTACAACTGCACAAGAGAGCAGAGAAAATCGCC
ACTTTGCTTTATGAAAGAGGACAGTTACGAGACGGAGACC
ACGTAGCCCTAGTTTATCCACCAGGTCTGGATCTGATCGC
TGCGTTTTATGGCTGCCTGTACGCAGGCTGCATTCCTATA
ACCGTGCGACCGCCTCATCCGCAGAATATCTCCACTACAC
TGCCTACAGTTAAAATGATCCTAGAGGTGAGTCGGTCAGT
GTGTGTAATGACCAGCCAAATGATATCAAAACTTCTCAAG
TCCAGAGACGCATCGGTGGCTGTGGACTTTAAATTGTGGC
CTCCAATCTTGGAAACAGATGACTTGCCAAAGAGACGTTG
TCCTCTGATGTTCAAGCCATGTGATCCAGACTCATTGGCG
TATCTGGACTTCAGTGTGTCCACTACAGGAATGCTGGCTG
GAGTGAAGATGTCTCACAATGCCACCAGTGCTCTGTGTCG
CTCGGTGAAGCTGCAGTGCGAGTTGTATCCGTCTCGTGAA
GTGGCCGTGTGTCTGGATCCGTACTGCGGCCTCGGCTTCG
TCTTGTGGTGTCTCTGCAGTGTGTATGCAGGCCAGCAGTC
TGTTTTGATCTCTCCGATGGATCTGGAGGTGAATCCTGCG
CTGTGGCTTCAGGCCGTCAGTCAGTTTAAAGTCAGAGACA
CGTTCTGCTCGTACTCAGTGATGGAGCTCTGCACCAGATC
TCTCAGCTCGCTCACTGACACGCTGAAGGCCCGAGGGATG
GACCTGACCCGCGTGCGCTCCTGTGTGGTGGTAGCAGAAG
AAAGGCCTCGTGTTGCTCTGACCCAGTCCTTCTGTAAGCT
CTTTAAAGACGTGGGGCTTCACCCGCGCGCCGTCAGCACC
GCCTTCGGCTGCAGGGTCAACCTCGCCATCTGCCTACAGG
GAACATCAGGACCCGATCCTACAACTGTCTATGTGGACAT
GAGAGCACTGAGACACGACAGGGTGAGACTGGTTGAAAGA
GGCTCTCCGCACAGTTTGCCTCTCATGGAATCTGGGAAGA
TTTTACCTGGTGTACGCATCATCATTGCTAACCCAGAGAC
GAAAGGACCAATCGGAGACTCTCATTTAGGGGAGATCTGG
GTCCACAGTCCGCAGAACGCCAGTGGATACTTCACTGTGT
TTGGCGAGGAAAATGTGCGTTCAGATCATTTTGGAGCCAG
GCTGAGCTTTGGAGACACTCAGACGGTGTGGGCCAGAACT
GGATACCTGGGGTTCCTGCGCAGAACTGACCTCACGGATG
CAAGCGGAGAAAGGCACGATGCCCTTTATGTGGTGGGAGC
ATTAGATGAAGTCATGGAGCTGAGAGGAATGAAATACCAT
CCCATTGACATTGAAACGTCCATCATCAGAGCACACCGCA
ATATCACAGAGTGTGCTGTGTTTACATGGACGAACCTCTT
GGTGGTGGTGGTGGAGCTGGAAGGTTCTGAGCAGGAGGCT
CTAGATCTGGTTCCAATGGTGACTAATGTGGTTCTAGAGG
AGCACTATTTGATTGTGGGTGTGGTAGTGGTGGTGGATAC
CGGCGTAATCCCCATCAACTCTCGTGGAGAAAAGCAACGC
ATGCACCTGAGAGACGGCTTCCTCGCTGACCAGCTCGACC
CCATATATGTGGCTTACAACATGTAGAAACGCACGCCGAT
GATATTAAACA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dip2cb-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000033096 (1),  Ensembl_Trans:ENSDART00000141399 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CF999776 (1) 704 nt
GenBank:CR928913 (1) 539 nt
GenBank:AL924595 (1) 470 nt
GenBank:BM187177 (1) 425 nt
GenBank:EB936123 (1) 374 nt
CITATIONS (2)