Transcript

adhfe1-201

ID
ZDB-TSCRIPT-090929-14211
Name
adhfe1-201
Previous Names
  • adhfe1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000033077 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000033077|OTTDARG00000025138|ZDB-GENE-040426-2070 adhfe1|OTTDARP00000026750 DKEY-97A13.13-001 LG_none BX663525.6,CT574558.4 Danio rerio protein_coding KNOWN, 1995 bp
GGCACGAGCAGACGTCATGGCGGGAGGTGAAAGAGTCGCG
CGTCTGATGCGTCAGCTCGCCAGCGCGGCGTGCAGATGCC
CCGCTCATTCTCAAGCATATTCTCACTCTTATAACCGAGC
TTCTGCAGGTGAGGCTCATGTTTGTGACAGGAAAACAGAC
TATGCTTTTGAAATGGCTTGTTCAAATATAAGGTTTGGAG
CAGGAGTTACCAGAGAAATTGGCATGGATTTGCAGAACAT
GGGAGCACGTAATGTGTGTCTGATGACTGACAGGACCTTG
TCTCAGCTGCCGCCAGTCGCAGCAGTTCTGGACTCACTGA
TAAAACATGGAGTCAAACACAAGCTCTATGAGGATGTACG
AGTAGAACCAACAGACAAAAGCTTTAAAGCAGCAATCGAT
TTTGCCAAAAAAGGGCATTTTGATGTGTATGTTGCTGTGG
GCGGCGGCTCTGTGATTGACACCTGTAAAGCAGCCAATCT
TTATGCATCTCATCCGGAGGCAGAGTTTCTAGACTTCGTC
AATGCACCAATCGGAAAAGGAAAACCCATCACAGCCACCC
TGAAGCCACTAATCGCTGTTCCCACTACAGCTGGAACGGG
GAGTGAAACCACAGGAGTGGCGATCTTTGACTTGGAGGAC
ATGAAGGCCAAAACTGGCATCGCAAATCGAGCCTTAAAAC
CTACATTGGGAATGGTGGATCCTCTACATACTCTTCACAT
GCCATCCAGAGTGGCAGCTAACAGCGGGTTTGATGTGCTC
TGTCATGCATTAGAGTCATTCACAGCATTGCCGTATAACC
TGCGTAGCCCCTGTCCGCCAAACCCCATCAGCCGGCCCGC
TTACCAGGGGAGCAATCCAATCAGTGATGTTTGGGCAAAG
CACGCTCTCCGGATCGTCGCTAAATACTTGAAACGGGCTG
TGCGTGACGCTGAAGATGTGGAGGCGCGCTCCAGCATGCA
CCTGGCCAGTGTGTTTGCAGGAATTGGCTTTGGCAACGCT
GGAGTCCATTTATGTCATGGAATGTCGTATCCTATTGCTG
GAAACGTCAAAACCCACAGAGCTAAAGGCTACAATGTGGA
GCATCCTATAGTGCCTCATGGACTCTCTGTAGTTCTTACT
TCACCTGCTGTTTTTGAATTCACTGCAAACATGTGTCCAG
AGCGCCACCTGGAGGCTGCTCAAATACTAGGTACTGATGT
GAGTAATGTTAAGAAAGACGATGCTGGTCGTGTGTTGGCC
GACACACTCAGAGCGTTTCTCTATGATCTGGAAGTGGAGG
ACGGTTTGTCTGCCATTGGCTATACCAAAGAGGACATCCC
ATCTCTGGTGAAGGGCACAATCCCTCAGGAGCGGGTCACT
AAACTGTCTCCACGGGCTCACACTGAAGAGGATCTGACGG
GTCTATTTGCTGCCTCCATGAAGCTCTACTAAGCAAACTG
AAGGACACTTTAACACATTGACGAGGTTCTTAGAAGCTCA
GCCTCTAATTAGCTGCACTGTTTTCATTATATAAGCAGAG
ACACCGATCTGAACACTAACCCCAATGAACTTTAATCCTT
TCACAGTGGTGAGTGGGTCGAGCATTTTTAATAAGACTAG
AAAGCACGATCTCACACACAGGTACTGTTTTCCTTGTATG
AAGCATGCTCATTTGGTGTATGCATATTTAAACGTAATTA
TAATGATTATAATGAGATTTTTACAAACCATACACACACA
GTACGCATCCTTACTTGCCATTCACTCTAACCCTTAAGGC
TAATTTGCTAATCAGTGATTTAAACAGGTTGGATTTAAAC
GTGTCTAATCTAAGAATCGGGATTAGACTTTAAATTGCCT
TTGTTTTTTTCTTGAATTGCCTTCTAATCTGATTTACTCA
TGCAGATTCAGTCATTCATGTTATTCACAAATGTTCATCT
GAAATGTTTTATTATTCACAGAATTTCACCAAATGATAGT
ATTAAAAATAAATGCAATAAACAGAAAGATCTAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations