header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-14211
Transcript Name: adhfe1-201
Previous Name: adhfe1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000033077 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000033077|OTTDARG00000025138|ZDB-GENE-040426-2070 adhfe1|OTTDARP00000026750 DKEY-97A13.13-001 LG_none BX663525.6,CT574558.4 Danio rerio protein_coding KNOWN, 1995 bp
GGCACGAGCAGACGTCATGGCGGGAGGTGAAAGAGTCGCG
CGTCTGATGCGTCAGCTCGCCAGCGCGGCGTGCAGATGCC
CCGCTCATTCTCAAGCATATTCTCACTCTTATAACCGAGC
TTCTGCAGGTGAGGCTCATGTTTGTGACAGGAAAACAGAC
TATGCTTTTGAAATGGCTTGTTCAAATATAAGGTTTGGAG
CAGGAGTTACCAGAGAAATTGGCATGGATTTGCAGAACAT
GGGAGCACGTAATGTGTGTCTGATGACTGACAGGACCTTG
TCTCAGCTGCCGCCAGTCGCAGCAGTTCTGGACTCACTGA
TAAAACATGGAGTCAAACACAAGCTCTATGAGGATGTACG
AGTAGAACCAACAGACAAAAGCTTTAAAGCAGCAATCGAT
TTTGCCAAAAAAGGGCATTTTGATGTGTATGTTGCTGTGG
GCGGCGGCTCTGTGATTGACACCTGTAAAGCAGCCAATCT
TTATGCATCTCATCCGGAGGCAGAGTTTCTAGACTTCGTC
AATGCACCAATCGGAAAAGGAAAACCCATCACAGCCACCC
TGAAGCCACTAATCGCTGTTCCCACTACAGCTGGAACGGG
GAGTGAAACCACAGGAGTGGCGATCTTTGACTTGGAGGAC
ATGAAGGCCAAAACTGGCATCGCAAATCGAGCCTTAAAAC
CTACATTGGGAATGGTGGATCCTCTACATACTCTTCACAT
GCCATCCAGAGTGGCAGCTAACAGCGGGTTTGATGTGCTC
TGTCATGCATTAGAGTCATTCACAGCATTGCCGTATAACC
TGCGTAGCCCCTGTCCGCCAAACCCCATCAGCCGGCCCGC
TTACCAGGGGAGCAATCCAATCAGTGATGTTTGGGCAAAG
CACGCTCTCCGGATCGTCGCTAAATACTTGAAACGGGCTG
TGCGTGACGCTGAAGATGTGGAGGCGCGCTCCAGCATGCA
CCTGGCCAGTGTGTTTGCAGGAATTGGCTTTGGCAACGCT
GGAGTCCATTTATGTCATGGAATGTCGTATCCTATTGCTG
GAAACGTCAAAACCCACAGAGCTAAAGGCTACAATGTGGA
GCATCCTATAGTGCCTCATGGACTCTCTGTAGTTCTTACT
TCACCTGCTGTTTTTGAATTCACTGCAAACATGTGTCCAG
AGCGCCACCTGGAGGCTGCTCAAATACTAGGTACTGATGT
GAGTAATGTTAAGAAAGACGATGCTGGTCGTGTGTTGGCC
GACACACTCAGAGCGTTTCTCTATGATCTGGAAGTGGAGG
ACGGTTTGTCTGCCATTGGCTATACCAAAGAGGACATCCC
ATCTCTGGTGAAGGGCACAATCCCTCAGGAGCGGGTCACT
AAACTGTCTCCACGGGCTCACACTGAAGAGGATCTGACGG
GTCTATTTGCTGCCTCCATGAAGCTCTACTAAGCAAACTG
AAGGACACTTTAACACATTGACGAGGTTCTTAGAAGCTCA
GCCTCTAATTAGCTGCACTGTTTTCATTATATAAGCAGAG
ACACCGATCTGAACACTAACCCCAATGAACTTTAATCCTT
TCACAGTGGTGAGTGGGTCGAGCATTTTTAATAAGACTAG
AAAGCACGATCTCACACACAGGTACTGTTTTCCTTGTATG
AAGCATGCTCATTTGGTGTATGCATATTTAAACGTAATTA
TAATGATTATAATGAGATTTTTACAAACCATACACACACA
GTACGCATCCTTACTTGCCATTCACTCTAACCCTTAAGGC
TAATTTGCTAATCAGTGATTTAAACAGGTTGGATTTAAAC
GTGTCTAATCTAAGAATCGGGATTAGACTTTAAATTGCCT
TTGTTTTTTTCTTGAATTGCCTTCTAATCTGATTTACTCA
TGCAGATTCAGTCATTCATGTTATTCACAAATGTTCATCT
GAAATGTTTTATTATTCACAGAATTTCACCAAATGATAGT
ATTAAAAATAAATGCAATAAACAGAAAGATCTAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
adhfe1-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000033077 (1),  Ensembl_Trans:ENSDART00000075551 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC066529 (1) 2007 bp
CITATIONS (2)