header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-14208
Transcript Name: vcpip1-202
Previous Name: vcpip1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000033074 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000033074|OTTDARG00000025136|ZDB-GENE-070912-613 vcpip1|OTTDARP00000026748 DKEY-97A13.11-001 LG_ BX663525.6 Danio rerio protein_coding NOVEL, 3654 bp
AAGGATAGGCGCATTTTATGCGGGATGTGCCCGGACCCGC
AGTGCCAGGCGAAGCTCATCTTCCCCGCACACACCTCCAT
GAGCATCGAGTGCACCGAGTGCGGACAGAGACACGAGCAG
AAGAATCTCGCCAATGTGGAGGAAGTGACTAACCCTGATG
TAGTGCTTCATAATTTGCTGAGAAATGCTTTGCTGGGTGT
GCCAGGCCCTCCCAAGAAGGGCTCAGAGCTGGTGAAAGTG
ATGGGACTGTCCAACTACCACTGCAAGCTGCTGTCACCCA
TCCTCACCCGCTATGGCATGGACAAACAGACAGGCACTGC
CAAACTCTTGAAGGAAATGAATCAGGGAGACATCTTTGAC
TGCTCGCTGCTTGGGGACCGTGCATTTCTCATCGAGCAAG
AGCATGTGTCCACTGTTGGGTATGGACGGGACCGGTCAGG
GAGCTTGATCTACTTGCATGACACTTTGGAGGAGATCAAG
AAAGCGAACGGTAATAGAGAGTGTCTTATTCCTGTGCATG
TGGACGGAGATGGACACTGCCTGGTCCACGCCGTGTCCAG
GGCGTTAGTTGGGCGCGAGCTTTTCTGGCACGCTCTTCGG
GAAAACCTTAAACTCCATTTCAAGCAGAACCTCGACCGCT
ACAAAGCTCTTTTCCAGGACTTCATAGATGCTGCAGAATG
GGAAGACATCATCAATGAGTGTGACCCGTTGTTTGTCCCT
CCAGAAGGCGTTCCACTGGGCCTGCGTAACATTCACATAT
TTGGCCTGGCCAATGTACTTCACAGACCTGTAATCCTTTT
GGACTCGCTGAGCGGTATGCGAAGCTCCGGTGATTACTCC
GCCACTTTCCTACCAGGCCTTATTCCAGAGGAGCAATGCC
GAGGGAAAGACGGCACTCTGAACAAGCCCATCTGCATCGC
CTGGAGCAGCTCTGGCAGAAATCACTATCTGCCTCTTGTG
GGCATCAAGGGCTTGGCTTTGCCCCGTTTGCCTGCTGCAC
TGCTTCCCAAAGCGTGGGGTGTTCCTCAGGAGCTCATCCG
CAAGTATGTGAGTTTGGATCCCAGCGGGAGCTGTGTGATT
GGGGGCGACCGGAGCCTCCAGGATAAGTACCTCCTGCGCC
TCGTAAGCGCCATGGAGGATGTCTTTATGGACAAGCACAG
CATCCATCCCGCTCTAGTAGCCGACGTCCATCAGTACATA
TACCGACGCACTGGAGTGATCGGCGTACAGCCGGAGGAGG
TGACGGAAGCGGCCAAGAAATCCATCCAGGAAGGCCGCCT
CCACCGCTGCCTGGTCTGCAACGCTCTTTCAGAGCTCCAC
GTACCAGCCGAATGGCTCATACCTGGAGGGAAACTCTACA
ACTTGGCCAAATCAACTCACGGGACGCTCCGAGCAGACAA
GAACTACAGTTTCCCATTAAATAGTTTAGTTTGTTCCTAC
AACCCAGAAAAAGATGTGCTCGTGCCTGATTATAAACTCA
GCTCGCTCACAACCTGCACCTGGTGTCATGGGACCTCAGT
ACGCAGAGTTCGGGGTGACGGCTCTGTGGTGTATTTGGAC
GGGGACCGCACTAACACTCCCTCTCAAGGTGGCAAGTGCG
GATGTGGGTTCAAACACTTCTGGGAAGGAAAGGAGTACGA
CAATCTTCCCGAAGCCTTCCCGATCACTCTGGAGTGGGCT
GGCCGTGTAGTCCGAGAAACTGTTTATTGGTTCCAGTACG
AAATTGATCCAACTCTCAATAGTAATGTATACGATGTGAC
CATGCGTCTCGTCACAAAGCACTTCCCTGGTGAATTCGGC
AGCGAAATCCTAGTCCAGAAGGTAGTGAACACCATCTTGC
ATCACACCGCAAAGAAGAGCCAAGATGAATACAACCCAGT
TGCCATCGAAGGTGCTCACGTGCAAAATAAAGTAGACGGA
GGTGAATCTTCTGCTCACCCTCCGACTAAAATCATCCTGA
CGGGACAGAAGGGAAAAACTCTCCATAAGGAGGAGCTGGT
CATGAGCAAAACCGAGAGGGTGTTGCAGCACAGCATCAGC
GAGCAGGCTGCCCTCTCCCAGCGCCGCAGCACAGATCGCG
TGCGCCATCAGGACCCTCGCCCATCATCTCCTTCCTCTTC
ATCATCCTCCGCTCCTCCCACTCCCACCAAAGTACCCCCA
ACCAGCGGAGAGAAGAAGATCCGTGTAACCACCAGCGACG
GGAGGCAGGCCATGCTTACTCTGCAGCCGCACACTACCTA
CAGTGATCTCCAGAACTCAATCATCCAGGTCTTCAACTTG
TCGCCCGGACAGCTGTGCATTCGTCATGGGTTCCCGCCCA
GAGAGCTGCCTCCACCACCTCCCGAAGACCAGAACCGGCC
CGTGGCGCTTCAGCATGGAGATCGGATTTCTGTGGAGGTG
CTGAAGGAGAGCTCTGCGGATCCTCAAGTAACCCAAACAC
ACACTCACAGCCCTCAAACACACGCTCACTCCGACCCACG
CCTCAGCCACAGCAGTAGCAGGGAACTTCAGGACAACATT
GACCTTGAGATGTCATCACTGTGTCTCCTGGCAGCACTCA
TGGGTGAAGATGTCTGGTCATATGCCAAGAAACTGCCTCA
CCTGTTCCAGCAAGGAGGAGTCTTCTACAATATTGTGAAG
AAAGACATGGGTCTCCTGGACGGGAAGCACTGCACACTGC
CCCACTTGTCGGGTAAGACGTTTGTGTTCAATGCAACCGA
GGAGCGTTTGGAGCTGTGTGTGGACACAGCCGGGCATTTT
CCAGTGGGCCCGGATGTGGAGGAGCTCGTCCAGGAGGCCC
TTTCACAGCTCCGCTCAGACGCAGCGTCTCGTAGCCGCGA
GGGAAGTCCCGCACACAGTTTGCGTCTGGGCTCCGGTGGT
GCCGTACGCAAGAAGGAGCAGAACATCACTGCCTTCCAAG
GTAAAGGGCACTCATTAGGTTCGGCCCCTCCTGAACATCC
ACCAATCAGGCGGCAGCACAGCAGCGGCGTTGACCTCAGC
GGCAGTGCCCGCGGAGAAGGGTTAACGTTGTCAGGGGAAG
ATTTAGTGCGTGTAGCTCCAGGCATGCTTACTTTACGTGA
GGGCCGCGGGATGGGGCTGGAGCCCGCTGTGATTGAGGCC
CAGCGTCAGCGCTTGCAGGAGATGGTATCTAACATACAGG
CGTCAATGGACAAACATTTGCGCCAGCACACTGCAGCAAG
GAATGATGGGAAGGAAGAAGAGACTCCTGACAAACCGGAG
GAGATGGAGAGTCACGGGCCGGAGCCTCCCAACACCTTTG
AACCGATGGACCAATCCTGATGCTTCATATACCCTCACAG
CAGAGATTCTGGCCTATGGAACAAACCTGGTGTCGTCTCA
GTGATACAGTTGTCTTTGGCACTTCTCCACATTGTACTAC
CCATTGCTGTCTTATCCAAAGAACACTACACGGTAAAAGT
CCTGAAATAAAATCACCTAAACATCTCACTTCACAGTCAG
AGCTCAGAAAACCTCTCTCAGCGAATCGGCATGGAGTGTG
TGTCCATCTGAGCGCCAGTTTCTGTTGTGTAATCTCAGAT
TGGCCTTTGAACTCTTATCAGCCTTGCCTTCAATGCAGTT
GTTCAGGCTCATCGGTTTTTGGTTTCGTTGTGTCCTTTTT
TTTCTTTGCATGTC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
vcpip1-202 Contained in:
[BAC] DKEY-97A13 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000033074 (1),  Ensembl_Trans:ENSDART00000134203 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:DT075431 (1) 483 bp
CITATIONS (2)