header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-14185
Transcript Name: si:dkey-97a13.6-001
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000033050 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000033050|OTTDARG00000025116|ZDB-GENE-070912-617 si:dkey-97a13.6|OTTDARP00000026727 DKEY-97A13.6-001 LG_ BX663525.6 Danio rerio protein_coding NOVEL, 6814 bp
CTCTGCAGATTTATACGTAAGAGAGCACTTCCATCCATAC
ATAATTAATGGACACCCAACTCTCAAACTACTCAGGATAA
AGGCAAACAAGGGAGGGTCCGCTATCATAGCAACTGATGA
CATCACTCGAAAATACTGTCTCTGCTCTCGAGATGGACAG
TCGTTCATCCTCCCAGCACGCTCTGACCTAGAGTCGCATC
GCATCATTATAACCACCACATCAATAGCCCGACATCTCCA
TGAGCTGAAACTTCCCAAAGGTTTCTTCACTCATATCTTG
ATTGATGAGGCATCTCAAATGCTGGAAGGTGAAGCTCTAA
TGGCTCTGGGCTTAGCAGACAAACACACTCGAGTGGTTTT
AGCAGGAGACCACATGCAGATGGCTCCAAAACTTTTCTCT
GTAACCGATGACAAGAGATCAGAACACACCCTGCTCAATC
GCCTCTTCCACTACTATCAGGATCAGAGCATCAACATCGC
CAAGAAAAGCAGAATAATCTTTAACGAGAACTACCGCTCG
ACCACAGAAATTGTGGATTTTGTATCCACTTACTTCTATG
TGAGTGATGGGATCAAGGCCAGAGGAGATGTGCATCCACA
CCCGAGGCTAAAACCCTTGATTTTTCATCATGTCAGAGGA
GAATGCCATCTGAGTTCCACCATCACATCCACATCATGGT
TAAATTATGCTGAGGTCAACAGTGTGGTAAACATGGTACA
AGTGCTTCTGACTGACTGGCCAATGGAATGGGGTGATAAA
GACCCAAAGCAGATTTGTGTTCTAAGTGAAGGCCAACAGG
TTGCTGCCATCAGAATACATCTCCGCAGGAAAGGATTTTA
TGGAGTGTCGGTTCAGAATTTAGCAAACATTCAAGGAAAA
CAGTTCAGGGTCATCATAATAACAACAGTCCACACAAGAG
ACAAACTTCTTCAGTTAGACTCAAGCTGCCCAGAGTTCTT
TGATGATATCCGTGCGCTAAACACCGCCTTGACCAGAGCC
CAGTCGCTAGTGGTTGTAATTGGAGATGCTGGTGCTCTTT
GTTGCTTTGGAAAGTGTTCAAAAGTCTGGAGGGCCTACAT
AGAACACTGCATCAGTAAGGGCAGCATTAAACCAGATCAT
TTCACCAGAGATGTCCTACAGCGAGAAGTGTTGGAAATTT
CAAAGTTTCAAAAGACAGAAAATGTTGAAAAGATTGAGAC
TGTTGTAAACCTCCAGGCTGAAACTGATGCTATATTGAAA
GAGATGGAGAACTATGATTCTGATGCACAGAAGTCTGATG
ATGACAATGAACAAAAGAGGCGGATATTCACTTCCGCTGA
AAAAGAAAACCTTTTGGAGATGGTCAGGAATCAGCCTGCT
CTCTACAAACGTGGAGAATTGGTGATGGAAGGATATCAGT
CAGGTTATATAATACCATATGACAACCCATCTGAACGCAT
TGATATTAAAGGGAGGAAAAACATTGGCATGTCTTTCCCT
GGTGATGAAGTTGTGGTTGAGATTAGACGACATGATGAAG
GGCATCTCACTGGAAGAGTTTTAGGGCTCACAAATAGATC
ACCAACATCCTCTGAATGTGTGTGTTCATTAGAAGATGAA
AATTACAATAGAAAAAAACTGAATCCTGACCAAAACCTGG
TGCCAAAAATGATGATACCCCTCGACCACACAACCACCAA
AATACGCATTTTGGTAAAGAAAGAGGCTCGCAAATTAATT
CCTCTGTGGAAATGTGTCAGTGGCAATTGGACAATAACAG
GAAGAGTTCCTATTAATGAACAAACAAAACAGAACTATGT
TTTTGTCGTGCAGATATTGGGCTGGAAAGAACACTGTTCC
TTTCCACTTGGTAGAGTTACAGATATTCTACCAGTTGGGA
CATCTTTAGAGGAGGGTCTTAAGATTTTAAAATCAGAATT
CAAACTAATGTCTCCTCCTCTGATGCAAGAGAACACGCTT
TTAGAAATCAGAATTGATGACAAGAGAAGAAAGGATTTTA
CAGGTTTAAAAACCTTTACTGTTGATCCACCTAACGCTGA
AGTCTTAGATGATGCCATCAGCATCAATGATCTTGGAAGC
TGCTATGAAATAGGAGTTCATGTTGCAGATGTAGCTAGTT
TTGTGTCTAAGGACAGTTCCATTGATGCATTCGCAAAGGA
TATGGGAGCAACCTTTTATGCACCTGGAAAAGAACCAGCA
TTTATGTTCCCCAAACATCTCTCCACCACCTGTTGGAGTC
TTCTCCCAGGCAAAGATCGGAAAGCAATTTCTTTAATTGT
TGAAGTGGAAAAGCAGTCAGGGGTCATCACAAAAAAGACC
TTTGATCTCTCTATGGTCAAATCTAAAAGGCAGCTGACCT
ACAATGAGGCTGAGGATATAATATGTCAGTGTGATGGTGA
ACTAAGATTTGATACATTGGAGGACTGTGTCCGAGTGGCT
TACCATTTTGCCAGAAGCCAGCGCAAAACACGACTTAAAG
AAGACTGGAGCTATGCCCAGCTTAATAAACACCAGAAGCC
AGGGGAGAGAGAAGCACATCGAATGATTGAAGAGTTAAAC
ATCATGTTTAACCATGAAGTGTCAAAATTTCTGTCAGAGT
ACACAGACACCAAATCCTGCACTCCTCTGAGGTGCCAGGA
TTCTCCTAATGCAGAAGCTTTAGAGAAGATTAGTAATCAA
CACATGGAACTCATTCCTTTTTCATCCCACCTGACATTTC
ATTTAGAGAGACAGCGAATGGACCTGAATAATGCAGTTAC
CTTCACTGTGTATTCTTTAGGGTCTAGATATGTTCACCCA
AACAATAATCCTAACCCTGAAGCTAACTCCAGCCCTTTAT
CAAGCCAACTACGAGATGCCATCTCTGTCAGCGAGTCTGA
ATTTCATTTTGAAATTGGAATTCACAAGGCAGATTTTTTA
AACTATGTGTCTGAGGACAATATTCAGAACTTGGGAGCAC
AATCAGACATGTGGAATTTGGCACCAGGCAAAAAACGCTG
TGCCATCTCTTTGATGCTGAAAGTAGAAAAGAGAAATGGG
AAACTAGTAGAGGAAAAGATGGTGCTTTCCCGCATTAGGT
CATGCAAGGCATTGTCCTACAGTGAGGCTGACAGCATCAT
CAACCAACTTGGAGAAAAAGAGATGAAATTTGGCACTCTG
GAAGACTGCATCCTTGTGGTTTGTCGTTTTGCACTTGATC
ACAGGACAAAGAGGCTCTCTAGACAGGTGAACAGTTCCAA
TCCCTCTGATCTTGCATCATCTGAAGACAGCAAGTGCAGG
TTAATGATGGAGGAGCTGAAACTGATGTTTAAAAGAGCTA
GTGATCAAATTATTAATCAACAAACCCAATTTCCAAACAC
CTCTCCTGGACTGGTGAATAGACTTAAGAAATACAATGAG
AAGTTTGAGTCTCTCCAAGTACTAGAGAAATGTCTGGATC
CAAACAACGGGCAGAACTGTGGAAGTTTCATCATTCTGAC
ATCTGTGTGGAAAAAGATCAAATCAGCAGCTTTGACATGT
GATTTCTACAAAATGGCTGACCTCATTTCTACAGATGACA
TTCATCCTCAATTGGTTCCGGCAATTGTTCAATTAAGTGC
CAGCATCAACAAAGCCTTCTTCATTCGTTCTCTCTCCTGC
AGAGAAGCTTTAGTTGGGCACTATTCATTACATCTAGACT
CTTACACACATGCATCTTCACCCATTCGGCGGTACATTGA
TGTGGTTCTTCAGAGGCTCATGCATGCAGTTCTCGGTAAT
CGTCCTGTAGAGTACTCTCAGACAGACATTGATCTGCTGT
GTGAAAAGTGTAAAAGAGGAGAAAAGAGGGCACAGGAGTA
TGAGAGCAAAGTTGAGGCACTTCAAATAGCAGTCAATCTA
CAGAAACAAAGCACATACAAAGTGGCTTTTGTCACCGTTG
TTAAACGGGACAGTGAAAGCTTTAAACTGTCATTTCCATT
TGACAAAGGAACTTTCCCGGAAAAGCTTCCTGTTCAGTAC
AGAAATTTACAGCTTGAAGATCAACCACTATTTATCAAAA
AGCCAAAACATGTGAAGCTAACGTGGAAAAAGCGTATATA
CGGATTGAGCATGACCCAGAGCCCCCTCCAGAACATGAAA
ATCTCTTCAGAGATTCAGCAGAGCACTTGGCAAGCTATTG
TTGAGGCTGTGAGAGACGAAAAGTGGGATGAGGCAAAGTC
TCTCGTATTGGCAGCACATGTGAAAGATAACAGCAGGAAC
AGTGAATTGTCTGATACATCTCGATGGGATCCTGATCGCA
CATTTACTTCTGAAGAGGATCATTACACTGACTTCCAAAT
TAATCTGAAAGTTGGAGACACTGTCCAGGTACAGCTGACC
TCAGAAAGGGACAGAGGCTACTGGGCACCAACTGTACAGT
TATTTAGATTGAGTTCAAGTTTTGAGATATGTGTGGAGCA
CACTGACAATCCTATCAAGTGCTTTTCCAGAATTGCAGAC
CATCCATCCAAAGGTTCCTACAGTAATGTAGAGGAATATG
TGCAGATATGGAGGCCCCTCTGTGAAATGGAGTCTGCTGC
AACGGCTGTGGATGATAGTGATTGTGTTGTGATAGAAAAT
GTGGCAATAACTTGGGACGATTCCAGACTCTCTGGAAACT
TCTCTCTACCTGAAGAGAATATCAAGAAATGGGCAATTGA
ATTTGACCTAGGCAGGTGTCTGCTCTGTATCCGAAAGAGA
GATCTAGAGCAGAACCAAGCAGAACAGTCAGAGCTGGATC
CAAAATATTTTACTTGGGTGGCCCATGCTGTGACAACACT
GTGTTCGGATTCTCCAGAGAACAGTGGGAATAAGTTTAAA
ATCATTAACTTTAATGTAAAATATGCATCCATGAAAATCC
CAAAATTTAAAAGGAATGAGACATTCACTGTGGAGATTAT
CCCAAAACTTCTTCCAGACATACGGAAGGAAAGTGCAGTG
AATAATCTAAAAGGAGCGAATGAACTTGTTCAGAACATTG
CACTAAAACACCGGATCGTGAACCAAAGCTCAAATCAAGA
TGTACCGCTATATTTGCTCATGAGAGAGGAAGCACCAGCA
GGTCTGCCTCAGCTGAATGAAAGTCAGTTTAAAGCTTTGG
AAAAAGCTCTGAATGGCAAATTCACCATCATTCAAGGACC
ACCAGGAACAGGAAAGACTGTTGTAGGAGCATATATCGTG
TACTGGTTCTCTCAGCTGAACTCTAGGAATCTTTGGAGGC
TGAAGGACCCGACAGACAAAGACAAGAGAGAGGTTATTCT
GTACTGTGGGCCCTCAAACAAGTCTGTAGATGTAGTTGCA
GAATACTTGCTCAAGTTTGGAGAGAAGCTGAAGCTACTAC
GTGTGTATAGTCGACAGATGGAGATGCAGGAGTATCCCTA
CCCAGGCAGCAACCTCCAGTTATCACACAAATCACGCCAG
GAGCGCTCTAAACCTGAGCTCAGAGCTATAACACTTCATC
ACAGGATTCGAATGGGACACAATCCTTATTCACAAAGAAT
AACTGACTTTGATGACAGAATTAAGAGTGACCCTTACTCA
CTGACAGACACAGACATAGAAGAATATAAGAAGCTGCTAA
ACGATGCACGTTTGCATGAACTGGAAAGGCATGATATTAT
TCTATGTACCTGCACGGCTGCTGCCTCCCCAAATCTCAAA
AAGACGCTCAGTGCACGACAGATCCTCATCGATGAGTGTG
CAATGGCAACAGAACCCCAGACGCTTGTCCCATTGGTCAG
CTTCAAACCTGAGAAGGTTGTGCTGTTGGGGGATCACAAA
CAGCTGCGCCCGATCGTGAAGAATAACCATGTGCGGAGAT
TAGGCATGACACGCTCTCTGTTTGAACGCTACATGGACAG
AGCAATAATGCTTGACACCCAGTACAGAATGCATGAAGAG
ATCTGCAAATTCCCATCAGAGGCATACTATAACGATATGC
TGAAAACTGTTGTGCGTGAACGGACAAGCGTGCTGAATGC
TGAAACTGAGGGAAGAAGACAAAGCAAGCGCATTCTGTTT
GGAGATATACGTGGAGAAGAAATCGGTTTAGTTGTTTCAA
CTGCACGAGGAAACGAGAACTCAAAAGCTAACTTTGATGA
AGTTAAGAAAGCGGTTGAGATTTGTATTCAGCTGGTAACA
GTGGGCCGTGTGAGACCAGAGGACATTGCCATTCTATCAC
CCTATAATGCACAGGTGGCTCAGATCAGAGAGAGACTGTC
TGATTTCGAATTGAAGGGATTCACTGTCACCACCATTACA
AAGAGCCAAGGTAGCGAATGGCAGTATGTGATACTGTCAA
TAGTTCGTTCCTGTCCCAGTGATGAGATTGAACCTATGCC
TTCAAGGGAATGGCTCTCCAAACACATTGGTTTTGTGGGC
GATGAAAACCAGATAAATGTGGGCATCACAAGAGCACAAG
TCGGCCTGTGCATTCTGGGTAATCAAGCAGTACTGAACTG
CAGCCCAGCGTGGCAGAAACTACTGAAACATTATTCAGGT
CATGGCTGTGTGGTCACTGCAGACCAAATAACAGTACACA
GGGTCCGTTAAATCAAGTTGGATTTATCTTGAAGCGTTTT
ACAATCAGTGTGTAAATATATATTTTTTACATTTGTATTT
TTAATAATCCCTTGCAAATTTTTATCATTCCACCCCTATT
TTAATGTAGGTACGATTGGTTTAATGAACAAACATATATG
AAAATGTAGCCATTAATATAATTTTCAATCAATTTAAACT
ATGGCAGCTTGAGAAATGAAATTGCATATATTTTGCTACC
TATATAGTTATATG

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-97a13.6-001 Contained in:
[BAC] DKEY-97A13 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000033050 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EE306128 (1) 903 bp
GenBank:DR724742 (1) 830 bp
GenBank:EB992062 (1) 805 bp
GenBank:EB992715 (1) 749 bp
CITATIONS (1)