header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-14184
Transcript Name: si:dkey-97a13.5-001
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000033049 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000033049|OTTDARG00000025115|ZDB-GENE-070912-616 si:dkey-97a13.5|no_translation DKEY-97A13.5-001 LG_ BX663525.6 Danio rerio processed_transcript PUTATIVE, 471 bp
CTGTTGAATTCACCTCAGATCAGTGTTGCTGTAATTCCTG
ATCTATGGAAAGAAGAATTGAATAAGCGAGCAACGCCACA
ACTACAGGGCCTGTTCTTTCTCTACTCATAATTTAAGTAA
CTGGATTATCCGTTGAATTTGTTTCTTCCTCTGACTGCTT
TCTCCATACCAACAACTACGACTGGTCTTCAGCTGCGCTC
CCCGGTCTGCTGTATTCTCCAGTCCAGAGTTTCACTGCCC
AGTGTTTGAATTTTAATTTATATATTTATTTATATATTTA
TTTACATTTTAATGATTTCTTGTTTACTTTTCTTGTTTGT
TTACCCTTTAGTTTAATTTATATATATATACTTTTATATA
TTTATATATATATATCTAAACTTTATTTTATACTGTTTGC
TTATAATTAGATACTGTATGTGTACTGTATGTATTAAATG
TTGTGAAATATATAATAAAAAGTTTGATTAT

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-97a13.5-001 Contained in:
[BAC] DKEY-97A13 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000033049 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CT646278 (1) 656 bp
GenBank:BI886815 (1) 636 bp
CITATIONS (1)