Transcript

hbl4-201

ID
ZDB-TSCRIPT-090929-14163
Name
hbl4-201
Previous Names
  • hbl4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000033027 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000033027|OTTDARG00000025103|ZDB-GENE-070912-287 hbl4|OTTDARP00000026712 CH211-284O19.5-001 LG_ AL954692.9 Danio rerio protein_coding NOVEL, 1112 bp
TTTAGGGGTCAAAAACTCCGTGTGAACGGAAGAAGTAACC
GTAGCAAAAAAAAAGCGTTTTAAAACTAGAACGTATTAGT
GTAAACGAGGCCGCAGTCGGAGTAAGAGTCTATACTGTTC
ACATTTATCACTTGGCGTGATCTGTTGTGAGCAGCAGATG
GCGCTGTTAAAGCATCAGCTCTGTGCTGTACTTCTCATGA
TGGAGTCTGGGCTTATATTATCCGCGTCTGAGAGTAGTTG
TCCATCTTATGCTGGTGTTCCTGGCATACCTGGAAACAAT
GGCAGCCCTGGCAGAGATGGAAGAGATGGGTTTCCTGGAC
CAAAAGGAGAAAAGGGAGATCTAGGAATTGGTGCACAGGG
ACCCCCAGGAAAAATAGGACCACCAGGAGCTCCTGGACAC
AAAGGGGACAGAGGAAGTCCAGGTTTATCAGGGACTGATG
TTCAAAATACATTAGTAACACAGCTTCGATCTGACGTCAA
ACACCTTACAGACAGACTCACTGTAATAGATAAAGTCCTT
GGATTTCGCATGTTCAAGAAAGTGGGACAGAAGTATTATG
TGTCTGATGGCCTGGTAGGAAATTTTGAAACGGCACAGAA
GTTCTGCTCTGATGCCGGGGCTAAAATTGTCCTGCCAAGA
AGTGAGGATGAGAATAAAGTGCTGATTTCATTGCAAGAGG
CCCTCGAGTCTACTTATGTACATGTTGGTGCAACAGATGC
AAAGAAAGAGGGGCATTTTGTAGATTTGAGCGACCAGCCT
CTAACTTTCACTAACTGGAAAGAAAAGGAGCCGAATGATT
ATAATGGGGCAGAGGATTGTACAGCTGTTTACAAAACTGG
TGTGTGGAATGACATTAACTGTAATTCAAAGTGGCATGTG
GTGTGTGAACTGTGAAACAGATTATGTTATTGTTACGATG
AATAAATAACAAGTGATTCAAAGGAAACTCACAATTAATA
AAATATTAGGTTTCTGTTATAGTGACATCACAAAGGTTGT
TGCTTGCTTTTTTAAGTGTTTAAGTTTTGCTTAGAAATGT
AATATAATTGTTCAAAGTGAACTGTGTGTTTAATTTTGAA
GATGCAATGAAAATAAATATTGAGTTACTTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations