Transcript

hbl1-202

ID
ZDB-TSCRIPT-090929-14161
Name
hbl1-202
Previous Names
  • hbl1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000033025 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000033025|OTTDARG00000025101|ZDB-GENE-070912-285 hbl1|OTTDARP00000026710 CH211-284O19.2-001 LG_ AL954692.9 Danio rerio protein_coding NOVEL, 1010 bp
GTCACGTCGGAAATTTTAGTTTTGTAGTATTTGTACGTTC
ACTAAAGGAGCGACTCTCCATTGAAGCACAGATGGCGCTG
TTGAAGCTGTTCCTCGGGGCTCTTCTGCTCCTTCAGCTTG
TTCTGCAGCTCCTAGCCGGAGCTGCTGACCCTCAAACCTT
GAACTGTCCTGCTTATGCTGGAGTTCCAGGCACTCCTGGA
CACAATGGTCTGCCTGGCAGAGACGGCAGAGACGGAAGAG
ATGGAGTCACTGGACCCAAAGGAGAGAAGGGAGAGCCAGG
AGTGAGTGTGCAGGGACCTCCTGGTAAAGCTGGACCACCT
GGACCTGATGGAGCCCAGGGTGAAAGCGGTCCACCAGGGT
CTCCTGGAAGTGAAAGTGTTATTGAGTCCCTGAAGTCTGA
GATCCAGAATCTTAAAGCCAAGATTGACACAATTGAGAAA
GCTGCGAGTTTCAGCAACTTCAGGAAAGTTGGACAGAAAT
ATTACGTCACTGATCGTATTTTTGGAACGTTCGATAATGG
CATAAAACTCTGCGAGAGCTCTAGTGGAACATTGGTTGTG
CCAAAAAGTTCTGCAGAAAATCAAGCTTTAGTCAGGGTGG
CAGCATCGAGTGGTTTAATTAATGAGAAGCCATATATTGG
AGTCACAGACAAAGAAACAGAAGGACAGTTTGTAGACATT
GAGGGGAAGCAACTAACATTTACCAAATGGGGACCAGGTC
AGCCTGATGATTATCAGGGAGCACAAGACTGTGGTGTAAT
AGATGTTTCTGGCACTTGGGATGATGGAAATTGTGGTGAC
ATACGTCCTATTATATGTGAAATAGACATCAAGTAGTAAC
TCTACCATATTTGCATGAAATGAGAATGCAGAAATTCCGT
ATTAAGGTTTTTTAAACAACCTATATGCTTTACAAATAGT
TTATATTTGAGTGTGAAGCATTCTTCAGAATGTAAAATGA
TACATTTAATATACATAACAAAAAATAAATGCACCGAATG
TTATGCAAAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations