Transcript

tep1-201

ID
ZDB-TSCRIPT-090929-14160
Name
tep1-201
Previous Names
  • tep1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000033024 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000033024|OTTDARG00000025100|ZDB-GENE-070912-283 si:ch211-284o19.1|OTTDARP00000026709 CH211-284O19.1-001 LG_ AL954692.9 Danio rerio protein_coding NOVEL, 1747 bp
GCTCACCGGTTTACTTCATTGTACACTAATAATACATGGT
CGCAAAGCGTTAAAGCTAAGCAGTCATGAAGGCTCCGGCT
CTCCTTCAGTCCGATCTGAAGGTAAATACGGACATCAGAC
TACAGCAAATTTGCCACAGTCCCCGGCTGGAAAACCGCAT
TTTGGCTCAAGCAGCCTCAGCATTGTCTCACCATCAGTAT
GCAGCTCCATCCTGGGCCAGTCAGACCCACATCTCCTCAG
CATGTCCAGCTCTCCAGCCAACCAGCCTGTCCTTAACCAG
GTCTTCCTCGTCCCTTCTGTCCTCCACAACGATGAGCTCT
ATCTCCTCTGATTCGTCCCTGCTGAGCACCAAAAACACCC
TTCTGATAGAGCCCCGACTCCACCTTCCAGCCTCATCCTC
TCTCACCTCCACCTGCTCCCAGAATCCTCTACTTTATTGC
TCTAAAATGTCCACAGCCAGCATCATCCCAAATATCTGCT
CCTATCCGTCAACTTCAGCAGAGGATAAAGTGAGCTCACA
TGAAAAGAGAGAAGAGGAAGGCATACTTTTATCAACCGAA
GGCCTGCTGGGAAATAGAGAGGAGCCCAAACAGGATGCCC
TCAGGATGTCTTCACAGGAAAGCTTGGATGGGGATGACCA
GATGCTGTCGTCTGAAGCGGCTGTTTTGGATATGGATGTA
GATGGAGTGGGGGAGCAGACTGTGGCCCTTCGTGAGGAGT
TTGGAGATCTTGAAGTAAGCAAAGAGGAGAAACTTGCTGA
ACTGAAGGACCGGAAGAACAACCTGTTGAATATGGTGTGC
TGCTCGCTGATTCAGAAGGGCTGTGCCCCAGGCCAGAAGG
ACTGGGATAACAAGAAGAGTGTGTGGAGCATTATCAAGAA
ACTAGCTACCGAGATTACCACAGAAGATCCTGAGTTTGTC
CTCAAGGTTGCAGTCTACACTAGGCAGGAACTGAACATTC
GTATCACAGCCAACTACCTGCTGGCGTTGGCTGCTCATCT
GCCTGCGTCTAAACAACACCTGAGAAGATACTTTTGTCCT
GCTGTGCAGCTGCCATCTGATTGGCTGGAAGTGGCACGTC
TCTATAGCATGTGTTTCAGTAAATCTTTACCCTCTTGCCT
GAAAAAAGCTCTTGTGGATAAATTTAAGCAGTTCAGCGAA
TATCAGCTGGCTAAATACAATACACGAAAGCATCGCTGCA
AACACAACAAAAACCAAAAGAAAGGAAAGAATATCTCGCC
CGAGGAGTGGAAGAAGTGGGGTGAGCTGCTCAGAGTCGAC
GAGCCCATTCTAAGAAAATATAAGCACACTAAAAAAGATA
AAAAAGAGAGTGAATTCAGCCTCAAGAAGATGGTAATGCG
CCTTCACATCAAGGAATCTGCAGAACATGTCATGGCCATT
CTGGGAAAGAAATACCCGAGTGATCTGAAGGCGTTCTCTC
GCAGTGGTCTTAGTGGGGTCTGGGACAGAGAGAGAGCCGG
AAAGCAGATGAAACTTAAGCAACCTGACACATGGGAGCGC
AAAGTTAGTCAGGAGGGAAACAAAGCTGCCACCTGGGAGA
AACTCATCGATGGGAAGTCTCTTCCTTTTATGGCCATGCT
CAGGAACCTGAGGAACATGATCACTGTGGGCATCAGCGAG
AAACATCACTCTAAGATTCTTAACAGACTGTCCTCGAAGA
ATGCTGTAATCCAGAGCAGGCAGTTTCCCTTCCGCTTCCT
GTCTGCTTATAAAGTCATTTTGGAGCT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations