Transcript

suv39h1b-201

ID
ZDB-TSCRIPT-090929-14149
Name
suv39h1b-201
Previous Names
  • suv39h1b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000032992 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000032992|OTTDARG00000025084|ZDB-GENE-030131-5105 suv39h1b|OTTDARP00000026683 suv39h1b-001 LG_ BX544876.8 Danio rerio protein_coding KNOWN, 3181 bp
AGCACATCTCCGTTTTTACTTTGAGTGACGTAAACAGCCT
TTTTGTTTCCTAGATGTTAGATTATGAAATTAAAGCCTTA
GTTCAAAAAATCGTATTGACTTTTTTGTCTCGCCTGGACA
CCAAAAATTAACCATTCTAGAGTAATTAAATGGGTAACCG
TTAAATGGAAAGCATCTCACAGATAACTAACGTTAGTGTC
TTCAAAATATTATCCATATCTGCCTGTAAAATCAGTCAAA
TTAAGATCTATTTTTCCTCAAAGTTCACACATTTAACGAA
TGTGGCATTTTGCATAAACTCTTCCCGATTTAAATACTCT
GCCACTATTGGTTGCTCAACCCGTCACTCAGACGGGGCGC
ATCCAACCACCGAGCAGCCTTTAGTTCCATAGTTTTGGCG
GCGTGAGACGATGGCGGAAAATTTGAAAGCTCAAGTTTGC
AGGGTAGCATGCATTGCTACGACAGAGCAGCTGGAGGTGG
TCTGTCGAGATGAGGGAGTGGTGTGCGAAGAGCTCGGCAT
CAGCAGGAACAACCTGTGTGATTATGAAGTGGAATATTTG
TGTGACTACAAAAGAAAAGTTATCACAGATGGGAAGAGGC
AAACAGTACAGGAGTTATACCTGGTGAAATGGAAAGGCTA
CCCAGAATCCAGAAACACATGGGAACCACGGAGGAACCTG
AGGTGCGTCAACCTGCTCTCTCAGTTCTGGGAGGATCTGA
ATGCAGAGATGCAGAGACAGAATAAACGTTCTGCCCCTCG
TCGTCTAGACCCCGCCACTGTAACACACCTCACTCAGCGA
GCGAAACTCCGGCAGACCCTCAAACAATGGGAGACTCACC
TCAACAGCCTGGGCACCCATAAGGGCTACATCTCTGTCCG
CAACCAGGTGGATCTGGAGGGTCCACCCAAAAGCTTCACC
TACATTAATGACTATAAAGTTGGAGATGGGATCCTGCTGA
ACGAGGTGTCCGTGGGCTGTGAGTGCACAGACTGTTTGGC
CAGCCCTGTGGAGGGTTGCTGTGCCGGAGCGTCCCAGCAT
AAGTTTGCATACAATGAGTTGGGTCAGGTCCGCATTCGGC
CTGGGTTGCCCATTTATGAATGCAACAAGAGGTGCCGCTG
TGGGCCTGACTGTTCCAACAGAGTGGTGCAGAGGGGCATC
CGGTATTCGCTCTGCATTTTCAGGACGGACAATGGCAGGG
GATGGGGAGTGCGGACCATGGAGCGAATTCGCAAGAACAC
TTTCGTCATGGAGTATGTCGGCGAGATCATCACAACAGAA
GAAGCAGAACGCCGAGGTCATGTATACGATAAAGAGGGCG
CCACTTACCTGTTTGACCTGGATTATGTGGACGATGAGTA
TACCGTGGATGCTGCTCATTATGGAAACATTTCCCACTTC
GTCAACCACAGCTGTGACCCCAACCTCCAGGTATATAATG
TATTTATTGATAACCTGGATGAGCGGCTGCCGCGGATCGC
GTTCTTCGCCACTCGTGGGATAAAGGCTGGAGAAGAGCTC
ACCTTTGACTACAACATGAAGATTGATCCAGTAGATGCCG
AGAGCACAAAGATGGATACTAATTTCGGTGTGATGGGACT
CCCAGGCTCCCCTAAGAAGCGCATGCGTGTGGAGTGCAAA
TGTGGGGTGGCGACCTGTCGAAAGTACCTATTTTAGAGCA
AGTGCATGCTAAAGAGAGACTGATGGAAGATCATGTGTTC
AACTGGAATGTGTTGAAAGCATCTGCAGTTTGCAAATTTA
GAATTTTAAGTAAATATTTAAGTTTTTTTAATTTCCTCAA
GATTAACCTCAACTTTTACCACAGACGTGTTTTCAAAAGA
GTATCAAATGTGGCATTAATCGTTCACTTTATATGTTAAC
AAACATGTAAGTGACGGTTTAAAACTAAATCATTTTTATA
AAATCATATGATCCGCATAAAATTCTTACAGAAAAGCTTT
TTAACATGCTTTATTTGCTCAAATTGGGATGGATTGTTTT
TTACTTCTGCTTTGTATTTTTTGCCCTGTTTTTAGTAAAT
ATTTTAGACCAGTGTAACATTTCTAAAATCTACAATCTCC
TTGATTTTTCGCTTGTCATGAAATTTCCACCAGGGGGCAA
AATATACCTATTAATGCACAGAAAGGGGTGTTTGTTGGAC
TGCAGAAGGTGGACCATCATCAGCTGCCTTTTACACATGC
TAAATGCTTTCATTATGTGTATATAGTCAAACAAATGACA
AAATACATTCATACTGTCAAACCCATATTTTAGAGTCTGT
CTTTGAGAGCAAGACTGGATGCATAAATGAGTTCAAGTGC
TTAAGTTGAATTATTATTTCACAGATCCGGTTAGTATCCA
GGGGCTGCATTTCCCAAAAGCAAAGTAATCCTATTGTTGG
CCTTGACATATAAAGCCTCCTCATGTTTATGTTGCTTTTG
GAAAATGGACCGTGAAGCTGGAGTGTTCTGTGGATTCCTG
AGAGATGGTATTTTAAGTCTGCAATTCTCACATGCTCAGA
AACATTTTAACATTCACACAACTATGAAACTGTCATCCTC
AAAATCAAACTATGTTGTATATATTGTAGGACTATAATTT
TTGTTTTTTTATTGGCTTTGTATTAAAAAAGAAAATCAAG
TTGTTTTGTCAGTCCTCACATTTATACTTGCACAAAAGTG
AGATCATTTTACACCATGTTGACAATGACAGCATAGGTTG
TACACTTAATGAAATAAACCAATCCGCTTTTATCAATCAT
AGACTTTTATTTCTATACTAACATGATAAAACACCTGATA
TTGACCACAGAATGTGTTCACAACCCTGTTCACACATTAA
TTCAGTGAGACGACAAAGCAATAAATTAGTGACTGAATAT
TTGGAGGGTCAAGTTTTGGAAGAAGGGATATCCAGGGGTG
AAAGATTTCTTCAATCCTCTCTGTTTACAATGGAGTGTAG
TCACCCGGTAACCTGATGCCGTGACTTCAGTGCAATGCGT
GACCTTTTGGGGTGATATCAGAGGCTTGGGGCACGCTTTA
AAAGAGCACTGCAAAAGGCCATATGCTTGCCCACAAACTG
ACAAGACAATTTGGAGACTTTATATTTTTTTCCGAAGCAG
ATGGGTGCAAAACTGCATGTTCTTCAAGTCCACTACAAAA
CAAAAACTCTGCAGTTGTTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations