ZFIN ID: ZDB-TSCRIPT-090929-14094
Transcript Name: mphosph8-201
Previous Names: mphosph8-001, zgc:162345-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000032774 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000032774|OTTDARG00000024973|ZDB-GENE-050309-191 mphosph8|OTTDARP00000026517 DKEY-19J7.1-001 LG_ BX649266.9 Danio rerio protein_coding KNOWN, 4109 bp
GTCGGTTATTCCTTCGCGATCTGGCAACCCAGAGTACTAT
CCCCGACAGCGGGCTGCTGCTGTGTCCGTGTGTATGTGCA
CTAGTTCGGCTGTCGTGCGGCCTTCATGCTGTTAGCATAT
CCATATAAACGACTCGTAAGCGTCAATACACTGCTTAAAT
AAAGCATAAATGGCGTCCGGAGCCGAGAGAGCGGAGCCTG
GAGACAGCGAACAGGATGAAGAAGATGTATATGAAGTGGA
GAGGATTATTGACGTGCGAGTGGAGGAGGGAGAGGTGCTG
TACAGGGTGCGATGGAAGAACTACTCCTCGGAAGATGACA
CCTGGGAACCTGAAGCGCACCTGGACGACTGCAAGGAGGT
GCTGCTGGCCTACAAGAAGGCTCTGGCTGAGTTGAAGCCA
AAAAAAGAACCTGCTATGCTTCCGATGAAGAGTGACCTGT
TTGATGCCGACTCTGAGAGTGACAGCGATAAAGAGAAACC
CAAAGAGTCACCTATGAAGAAAAAGAAGAAGAAGAAAAAG
AAGAAAATTGAGGACTCGGATGATGAGATGTCTGTGAGAG
AGAAGAAGAAGAAGAAAAAGAAGGAAAAATGGCGAGAGGA
CAAGCCTCTGCCTGCGCCTGAGTCTGATGAAGAGGAGAGC
AGGGATCCTTCACCCGCACCTTCTAAGAAAGAAACCAAGA
AGAGGTTCATTGACTCTGATGATGAGGATGTCCCAGTTAC
TCCTAAGAAACAGAAGAAGCTTGACAAGCCTAAAGATGCA
GGAAAGGTGAAGAAAGAGAGCGGAGAGGAACGCAAGAAAA
AGAAAATCAAGTCCAAAAGAGAGATTGATTCTTCGGACGA
AGATGAGAAGAGTGACGCGCCATCTGAGTCCCACACAGAT
GATACAACAAACACAGAAACAAATGATTCCTTCAAAACGA
CAACAAAAATCACAGAGAAACCCGTTCGTAGTGAAAGTGG
AGGCGACCTCAAGCAGGTCAAGCAGAAGAAAGACAAGTCT
GACATCAAGCTGCAAGGTTTCAAAGACCTGATACTAGAGA
AGAAGCCTAAAAAACCAGAGGCTTCATCGGCAGCAGCCAA
AGACGTTGGTTTGAACAAGATCAAGAGCCTTACTGGTAGC
AAGAGCACTAGCAAGTCTTCTCGTAGTGAAGAAGAGCCTG
ATTCCAGTGACACAGGGGCGGCAGCATCCGCACCCAAGGC
AAAGGTGAAAAGCAAAAGTCAAGAAGCTGCTCCGTCTTCT
CAGAGGCTCTCCTCTGCATCTTCCTCCTCATCATCTTCCA
CAGCATCAACAGCCCCCATCAAACCCAGAGAGGATGAGGC
AAAGGAAGAAGCTGGTGACAAAGCTAGTGCCTCCAACCTC
TTTGAGAAGTTCCTGTTGAACTGTGAGGCGAAAGATCGAG
CACCAAGAAGACAAGTGGACCAGAACAAGAGCGCAACACC
AAAAGGTGGCAGCAAAAATGACAAGAAAACAAAACCGTCA
AAGCAGTCTCCGGGACGCAAACCTGATTCAGACAAGACAA
AAGATGTGCCACGATCCAGTCAGAGTCCCATCTCCATGGA
GGTTGATGAGAAACAGGAGAAGGGATCATCAGAGTTAGAA
AAAAGTGAAAAATCAGATGAGCCGAACTTCAAATCTAAGG
AGGAATTGCAACGGGAGCAGAGAGAAGAGGAGCAAAGGAA
GAGGAAAGAGAAGATGGAAGAAGAAGAGAGAAAAAGGAAA
GAAAGGATCGAAGAAGAAGAGAGAAAGAAGAAAGAAAGAA
TAGAGGAAGCACAGCGGGAGAGAAAAGCACGCCTGGAGGA
GGCACAGAGATTTGCAGAGGAGGCCCGGCAAGAGCTAGAA
AGGAAGTCTATGGCTGAGTCAATCGTGTCTCCAGACTCTA
CAGAAGACTCCAGGTGGAAGGACAAGAGGAGGAAAAGGAG
GGATGACAGTGAATCACGGGTTTTCACCACCTGCGATGAC
AATCAGGACTCTCAGGAGACTGTGGAACGCTCAGACAAAA
CTCCTGACAGGGGACCACCATCCCTTAATCTTGGCGTTGA
GCTCAAGCTAGACTGGATGACACTGGAGGACTTTCAGAAA
CACTTGAATGGAGAGGATGAAAATCTCTCTCCGCTAGCCT
TAACACCCACCGAGCTACGAGAAGCAGTGAAGAACGGGAA
TTACTTGGCGGTGAAACGTGCTCTTAGTTCAAAAGAGGAC
TACAATCTGGACCAGGAGGACTCTAGCGGTATGTCTTTAA
CGCTGCTGGCTGCTGCAGGCGGTCAGGATGACATCCTCAG
GCTGCTCATTAAGAAAGGAGTAAAGGTCAACTCCAGACAG
AAGACTGGCACCACGGCACTGATGCATGCTGCTGACAAGA
ACTTCTTGACGACAGTGGCCATTCTTCTGGAGGCAGGAGC
TTTTGTAAATGCTCAAACTCTGGGTGGAGAAACGGCTCTC
ATGAAGGCTTGTAAGAGGGGCAATGCAGATGTGGTTCGCC
TCCTGCTGGAATATGGAGCTGACTGCAACATCCTATCCAA
ACACAAGAACACTGCCTTGTACTATGCCAAACTCAGTAAC
AATCTGATGGTGTATGATCTGATCAAAGACCACATGCAGA
CGTTATCAACAGTAGCGGAGGAGACAATCAGAGCTTATTT
TGAAACCCGACTGGCTCTGCTGGAACCTGTATTTCCTTTG
GCTTGCCACAGATTGTGTGAGGGACCAGACTTTTCACTAG
AGTTCAATTACAAACCCCCACAACACGCACCAGGAGAAGG
TTCTGGAATCCTACTCTTTATCTTCCATGCAAACTTCCTC
AATGAAATCACAGCTAGACTCTGCGGGCCCTGTAGTGTTC
ATGCTGTGGTACTGAATGACAAATTTCAGCTGCCCATCTT
CTTGGACAGCCATTTCATTTACTCTTTCAGCCCTGTTCAA
GGAGCCAACAAAATGTTCATCCGTCTGGCAGAGTCCCCCA
CAGCTAAGGTGAAACTCCTCATTTGTGCGTACAGAGTCCA
GCTACAGTGAAGTCAGAGGGTCACTGCAGGAGCTCGTCCT
CTCCAAAAACTGAGACTTTTCCTACACCTGCTGAACATGA
GATTCTTTAGGAATGGTTTAGTTTTACTTGTGTGGAATAA
ACTGAAAGACAGTAATACTAACAGGTCAATGACAACAGTC
ACAGTTCTCAGCGTGACTTATAAGTTCTTGTTTAGCTAAG
TGTTGCAACCAGTTTCCAGAGGTCCGATTTTTGTGAATTG
AAACTGCATCACCCTCGAGGTCAGCATGAAATATGATAAA
TTCGGGCTTGCGTCTGAAGGTCATTTGTAAATCTTGTTTG
TATAGTGTTCCTTTTATTTCATTTCTTTTTAAATAGAATA
ATTTATCACTCCAGATTCTCACCCACTGTTTCGTTTTATG
TTCGGTGTGTTTAACCAGACAGCGCACTTGTCTGATGTGT
GCAGAATGAATGAAAGAATGAGCAGTTCTCATCTCCCTGT
TGCTTTGCATTCTAGGGGCCACAAAAAAAAAAAAAAAAAC
TGGACACCAGTGTGACTGAACATCAGAAACGTGTGCTTTA
AAACATTTTCTTTGCAGAGAATGTGATTTTAATCCTAAAT
TGGATCTATAATGAAGCCATTATTTTTGGAAGAAATGTAT
GAATGTGTACGTTTAGCTTGTTCACTATTTTAAGGGCTAA
TGTGTGATTGCATTGAGAGGAGGATCCACACAGGTTGAAG
TCATCCAGGTAGAAGCGATTATTAGAACGGGTCACTTTTA
TGCTGGTTAGCAGCGATCGTGACTCTTTTTACATGTCGTC
GTGCAGGTTGAACACCAGCCCGGTTTAATTTCTTATTAGA
TTTCACATTACAAATCAAATCACTTGACTGAACTGAAGAG
TCCGATCTTATTTTGAGTTTGGACGTGCAGTGAAGGCTTC
TTCTATTGTGTTGTTCATGGCCTGCCTCTCTTCGTCCTGT
CATTGTACTATTAGTAAGTGAGAGAACGACTGCTCATTGA
TTCATTTCCTCTTTTGACTACAGTAAATAAACTGTACATA
TATTTCCATAACAATCAGTTTTATTCTTTTCTCTTTAATA
CAGAAACAAGGAATAAACGGTTCTCTAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mphosph8-201 Contained in:
[BAC] DKEY-19J7 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000032774 (1),  Ensembl_Trans:ENSDART00000080404 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC133954 (1) 1021 nt
GenBank:BC124620 (1) 912 nt
GenBank:CD759020 (1) 835 nt
GenBank:DT062923 (1) 812 nt
GenBank:CV484234 (1) 793 nt
GenBank:CT647011 (1) 704 nt
GenBank:CT709157 (1) 652 nt
GenBank:CD594274 (1) 650 nt
GenBank:CT681712 (1) 619 nt
GenBank:EH439973 (1) 592 nt
GenBank:EH465881 (1) 568 nt
GenBank:EB916120 (1) 516 nt
GenBank:EH544134 (1) 472 nt
GenBank:EB965850 (1) 419 nt
GenBank:EH537761 (1) 374 nt
CITATIONS (2)