Transcript

si:dkey-181m9.8-202

ID
ZDB-TSCRIPT-090929-14065
Name
si:dkey-181m9.8-202
Previous Names
  • si:dkey-181m9.8-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000032737 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000032737|OTTDARG00000024951|ZDB-GENE-070912-399 si:dkey-181m9.8|OTTDARP00000026489 DKEY-181M9.8-001 LG_ BX248497.11 Danio rerio protein_coding NOVEL, 1985 bp
AAGACGCAACAGATATGATTTCCCGTTCATATTGTAAAAT
TACTTGACGATGAATGCATGAGCAGTGCTCGTGCTGTTAG
AGGATGTCGCGCGTTTCAGCAGAACTGAACTATCAAACAC
TTCTCGAGTGTAGTTACTGCTACCCAGATGAAGTGCTTGA
AGACATCAGAAATTTGTCTGCAGATTTCCCACATCTCCAG
TTATACGTGGACTATTATCTCTATCCCAACAACGATAAGA
AGAAGTTGGTTTATTTGGGTGGCACAGTTCCTGTCGCATA
TGAAGGTGGCAAGTACAATATTCCAGTATGCATCTGGATC
CACGAGACCCATCCGAAAAACCCACCTAGGTGTTTTGTCT
GCCCTTCACCCTCCATGGTGATCAACACTAAAAGCAGCAA
TGTGGATGCCAATGGTCGAGTTCTTCTCCACTGTCTCAGC
AACTGGAAGATTGGGTGGTCAAACTTGCCAATTGTCCTGG
AGGAGATGATTGCTGCCTTCCAGCGTGAAACTCCTCTGTT
TGCCACATATCCAGCCCAAACGCCACAAACAAAGCACCTG
CCGGCTGAACTGGTTCAACCCAATCCTATCCCAGGTGGCA
TCCAAGGTGACAAGGCTGAAATGTTTAGGAGCATCATGAG
TCTGGAGGGATGCAGCTTCAGCTCCACAGATGTGCTGGAA
GCAGTGCAGTCGTGCCGAGATCTTCCATCTGCTCTCAAAT
ATCTCTGCCACGATTGTCCTATTTGCCAGGAGCAAGTATC
CTTCAACAGGATGGTCACCATGACACACTGCTCCTGTACG
TTCTGTGAGAGCTGTTTTAAGAAGTACTTTTCCTCTGTCA
TTAAGGAGAAGAATATAGTTCATGCTGTGTGTCCTCTCTG
TAATCTTCCTGATGTACGAGGAGGCCGCAGGGAGGACACC
ATGGAGTACTTCAGTCTACTGGACACACAGATCAGGTATT
ATTTGGACTCCCAGATTCATGAGCTTTTTCAGAGGAAACT
TCGAGACAGAGCACTGCAGGAAATGCCCAACTTCCGCTGG
TGTGCACATTGCTGCTTTGGGCTCCTTCATGAAGCAGACA
GGCTGAGAATGGACTGCCCCAGTTGTGGGAAAAGCACATG
CTTTAAGTGTAAAAGGCCGTGGGCTCCACAGCATGAAGGA
ATCTCATGTGAGAAGTTTAAAGAGTGGGAGCAACTCAACA
GCCCCGAGTACCAAAACTCCAGGCTAGAGCAGCTCCTCAG
CAGGAACAAAATAGACTGCCCAAAATGCAAATTCCGCTTC
TTCCTGGCCAGAGGAGGCTGTTTGCATTTCAGATGCACTC
AGTGCCAGCATGAATTCTGTGGTGGCTGCAGTCAGCCGTT
TAAACAAGGCTCTACCTGTAATTTTTCCATCGAGTGCGCA
GCTAAAGGGTTACATGCGCACCATCCTCGAAACTGCCTAT
ATCATCTGAGAGACTGGAGCGTCCCGCGACTACGTACCTT
GCTGCAGCGCTATGGAGTATCACATCCGCTCATGTTTAGC
CCCAAACATCCAATGGGGAGACACTCTAAAGGCATCTGTG
GTGTAATGGAATTCCAGGAAACAGGAGCTGTGAAAGAAGA
GGCATGTGGACGACAAGCTTTCCCAGAGTACAGCGGTTAC
TGCACGTTGCATTATAAAGAGGTTCTGGTGGAGCTGATAA
ACAGCAATGGACTGGACCCTGTGGTACTGTTAGATGGGGC
AGAACTGAGGGCAGAAATGGACCGCTGGAAAGTGCCACTT
CCAGAAAGACATCCTTTGGAGCCGGATCAGCGGTACGATG
ACAGACTTCGACAGATCTTAAAGGAGCGGGTGGTTCTGGG
CAGTGGTGCAGCTCCTGGATTGAAAGCAGCTGCTCCACCC
ACTCCATCTCCCTCTTCTCCTCCAGAGGCCGGGGCTCCAT
GGTACTCCATCCTGAACCGGGCAGTTTCTGAGGACTCACA
ACAACTCCTGCTGCTGACCGACTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations