ZFIN ID: ZDB-TSCRIPT-090929-1403
Transcript Name: strap-201
Previous Name: strap-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000009149 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000009149|OTTDARG00000008033|ZDB-GENE-040426-1110 strap|OTTDARP00000007885 strap-001 LG_ BX649476.3 Danio rerio protein_coding KNOWN, 1823 bp
GCTTCCATTATGTTCCTGTAGCGTTAGCGAGGGCTCGAGT
TTAGCTTACACACACACACACTCACACACACACACCTCGT
GTAGCTGGTGGCACAGCACTGTAGCTGGGAGTGCAGCTCC
GCAATCATCCCCGATACGCAATCTGGCCGCAAAGTACTAG
TGTGTGACGTTGATTTGCTAGCTTTGCAAGGTCCTCAGTA
AGTATGGCCATGAGACAGACCCCTCTCACCTGCTCTGGTC
ACACCAGACCTGTTGTGGATCTGGCGTTCAGTGGAATAAC
TCCTTATGGATATTTCCTCATTAGTGCTTGTAAAGATGGC
AAACCTATGTTGCGCCAGGGTGACACAGGGGACTGGATTG
GGACGTTCTTGGGTCACAAGGGTGCTGTCTGGGGTGCCAC
CTTGAATACAGAAGCTACAAAAGCAGCAACGGCCGCAGCA
GATTTTACAGCGAAGGTATGGGATGCTGTCACTGGAGACG
AGGTCCTCACCCTGGCGCACAAGCACATTGTGAAGTCTGT
AAACTTTACACAGGACAGTAACTATCTCCTGACTGGAGGA
AATGATAAAGTACTGCGCATCTATGACCTCAGCAAACCTG
AAGCAGAACCCCAGGAGATTGCAGGCCACACTTCTGCCAT
AAAGAAAGCACTGTGGTGTAACAATGACCAGCAGATTCTT
TCAGCTGCCGACGACAAAACCATCAGACTTTGGGACAAGA
ACACAAACGAGGCGGTGAAGACTTTATCATTCGATGCATC
TGTCAGCAGCATGGAGTACATTCCTGATGGGGAGACTCTC
GTCATCACATACGGGAGAACCATCGCTTTCTATAATGCCC
ACAGTTTGGACCTGATTAAGACCGTAGACGCCCCTGCTTC
CATTCACTCCGCTTCCCTGCATCCTGATAAAGACTTCTTT
GTGGCTGGAGGAGATGATTTCAAGCTTTACAAATATGACT
ACACCACCAAAGAGGAAATGGAGTCATATAAGGGTCACTT
CGGGCCTGTGCACTGTGTGCGGTTTAGTCCTGATGGAGAG
CTGTATGCCAGTGGCTCGGAGGATGGCACTCTGCGTCTGT
GGCAGACAGCTGTAGGCAAAACATACGGCCTTTGGAAATG
TGTCCTGCCTGAGGAGCTGTCATCAGAGAACTCTGAAGCG
CTTTACTGCCCTCCAGCAGAGATCAAGGCCTGAGTCAGGA
AAAAGAGAGAGACAACGAGGCAAAGGAGGAAAGATCACGG
GACAGGGAGAGGTCAGGGGACGGGACGGGTCAAGAAACCA
CACCCCAGCAGAGTGCTGTGCCACCACCCTTCTTCACTAG
AGACAGACCGCGCTGCCAAGCATGACTTTTAAACGTGAAG
ATGAAACCCACACGTACGCATTGTGGAAAATCAGGAGACG
GCGGTAGAGCTGAGAGTGCTAGTGCTAATGCTAATCCTCC
AGCTGCCTGCTCTTTCTTTGATAGCCATGAAGCATCAGTC
AGCTCCTTGGTATAAAAGCGGTCGGTTTCTGCAGCACTGT
GATCACTTTGGTTGAGATTTACTTTTGTTTTGTTTTATTT
TGGTGTTATAATGTGCTTTCAGTACAATTTGTTTGTTATC
GCAAGAGCTCAGTGTTCAGTTTGAAAACATCTCTCAGCAG
AAGTGCTTTTGAGGAACTTGCTATTCAAGTGTTTATCAAT
AGTAGTGTGAACTTGTGGTAAATGTTTTCCATGAGTGCTC
GGGAAATTTGTAAAACTTTAAAGTGACTTAAGTTCTTTAA
TCGTTTTGTCTTTGGTTGCAACATATGTTGTATCATTTGG
CCAATAAAATGTTGTACCTTTAT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
strap-201 Contained in:
[BAC] DKEY-13I19 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000009149 (1),  Ensembl_Trans:ENSDART00000124627 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC049525 (1) 1842 nt
GenBank:CF265966 (1) 947 nt
GenBank:CD759071 (1) 840 nt
GenBank:CA474969 (1) 825 nt
GenBank:CK236091 (1) 822 nt
GenBank:CK361891 (1) 805 nt
GenBank:BM315910 (1) 699 nt
GenBank:BI886456 (1) 695 nt
GenBank:BQ616489 (1) 675 nt
GenBank:AW232894 (1) 654 nt
GenBank:BM957378 (1) 635 nt
GenBank:BQ078641 (1) 634 nt
GenBank:BM184442 (1) 628 nt
GenBank:BM957018 (1) 595 nt
GenBank:BQ078328 (1) 587 nt
GenBank:BM181821 (1) 554 nt
GenBank:BQ260796 (1) 536 nt
GenBank:AL926222 (1) 534 nt
GenBank:BQ078435 (1) 519 nt
GenBank:BQ078763 (1) 503 nt
GenBank:BM184140 (1) 496 nt
GenBank:BQ616167 (1) 486 nt
GenBank:BG728861 (1) 416 nt
GenBank:CD053265 (1) 267 nt
CITATIONS (2)