ZFIN ID: ZDB-TSCRIPT-090929-14020
Transcript Name: si:dkeyp-106c3.2-201
Previous Name: si:dkeyp-106c3.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000032688 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000032688|OTTDARG00000024921|ZDB-GENE-070705-527 si:dkeyp-106c3.2|OTTDARP00000026448 DKEYP-106C3.2-001 LG_ CR392352.6 Danio rerio protein_coding NOVEL, 1009 bp
GCCTATTTTCAAAACAAAAGCCGCGGTTTTCAAGTTATGA
TGACGTTTGTTATACATTATATTTAGTTACACATTATACT
TGGTTACAAAGCGTTGGTTAATTTAAGTTGACTTTTCTCG
TTAGCAACACGCTAAAGTTTTGTTCACTCGGTCCGAGGGC
AGCGTCTCATGAACAGACAGACAGAAATGTCAGAGCTTGG
TCTAGGACGAAAACGAAGAATTGACATCTGGTCAAACTTC
ACATATGACAACAAGGACAACAAGAGCGTCTGTAAACCAT
GTGGAGTAAAAATCGCTGGGAAAAACACCACCAACTTGAA
GCGACATTTACAGACGGCTCATCCAGAAATCCACACCAAG
ATACAGAAGATGTCTGATGACCATGGGCCAGGTGGAAATA
AAGCTAGTGATGCTACTAGTACAACACAGCAGCAGGCCAT
CTCAGATTTCCTAAGGTCTTCAAAGTACAAGACTGAATCA
AAGGAACAACAGACCAAGGAGCAGGCCATAGCTAGATAGA
TTGGACGGACAGGTTTACCACTCACAACAATTGAGGATGA
GGACTTTGTGCTAATGATGGGGATGATAGATGGGAGACTA
ACAGTTCCAAAGAAAACTAAAAATAGCAATTTAATTAAAA
CACAGTATGAATGCTGTACTTTATCTTGAAAGAATGTCAT
ATGCGTTTCATATAATTCAGGGACAATGCATATCTTTTTC
AGGGAGCATGTATATTGTTCAGGGAGAGCAGGTCTTGTGG
TTATTTTTTGTGAAAAAGACTCATGTTTTTGACATGTAAT
AAAATGTTTTTATTACAACAATTAGATATGTGCCTGTATT
CTATATATGCTTCCATATATTATATTATACTTACAATTAC
ATGAATTATGGAGAAAAATCTGCTAATATTTGGTCTACTA
AGACTAATAGACTTAAGACTAAACTAAGACTAAAACTTTT
ATGATATTTAGTCAACTAAACTAGACTAAGACTAAAAGAT
TTCAGATGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkeyp-106c3.2-201 Contained in:
[BAC] DKEYP-106C3 (1)

Genome Resources: Vega_Trans:OTTDART00000032688 (1),  Ensembl_Trans:ENSDART00000134171 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CF995878 (1) 758 nt
GenBank:EB832896 (1) 594 nt
GenBank:EH482970 (1) 558 nt
CITATIONS (2)