ZFIN ID: ZDB-TSCRIPT-090929-13946
Transcript Name: coq5-201
Previous Names: coq5-001, zgc:92445-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000032563 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000032563|OTTDARG00000024846|ZDB-GENE-040912-5 coq5|OTTDARP00000026364 DKEYP-7C9.2-001 LG_ CT737139.10 Danio rerio protein_coding KNOWN, 1546 bp
GAGATGTTTACGCAACTAAATTTGAAAGAAACATGGCGGC
CCCCATCAGGGCATTTGTCCTTAGAGTTCTCTCCGATTCC
ACTAGAAATGTTCATCATGTTTCACGGTGTCGAAGCAAAT
ATTTATGTCGTCGTGCTGCAATCACAGCATGTCGTGGATA
TAGCGACAGCACGGAGGGCAGAAGTACGCACTTTGGTTTC
CAAACAGTCCCAGAAGAAGAGAAAGCAGAGAAAGTGTATA
AGGTCTTTGAAAGTGTGGCCAAGAAGTATGACGTGATGAA
TGACGCCATGAGTTTGGGGATCCACAGGCTGTGGAAAGAC
ACACTTCTACACATCATGAACCCTCAGCCGGGATTGCGGC
TGCTTGACACGGCTGGTGGCACAGGTGACATCTCCTTTCG
CTTTCTGGAGTACACACGCTCGATGTACGATCGCCAGCAG
CGGCTCAGAGCAAAATCCCAGCAGACTCCGTCATGGAAAG
ACATCGCGGGTCACTACGTGTCTGACGAAGAAGGTCCTCC
ACAGTCGCGGGCAGTGGTGTGTGACATCAACAAAGAGATG
CTCAAAGTTGGAAAACAAAGAGCAGAGGACGCAGGAATCA
CTACAGGACTTTCGTGGGTTGCGGGGGATGCCGAAGAGCT
GCCGTTCGACGACGATCAGTTTGACATGTACACGATTGCG
TTCGGCATCAGAAACGTCACCCACATCGAGCAAGCTTTAC
AAGAGGCTTTTCGGGTCCTTAAGCCAGGCGGACGTTTTAT
GTGTCTAGAATTCAGCAAAGTCACCAATCCTCTTCTCGCA
AGACTTTATGATGCATACAGTTTTCAGATGATCCCTGTAT
TGGGTGAAGTAATCGCTGGAGACTGGAAATCATATCAGTA
TTTGGTGGAAAGTATCCGAAAGTTCCCAGACCAGGAAACA
TTCAAGGAAATGATTGAAGATGCTGGTTTCTTCCGCGTCC
AGTACTTCAACCTGACTGGAGGAATTGTTGCCATTCATTC
AGGATTCAAGCTCTGAGTGTCAGAGTGAACCAAAGCTGTT
TGAACACATTCGAGTATTACCATCTCTCTAAATGAACTCT
GACAAGAAAGAGTGCTGTTGTATAAACAATGACTGGAGGA
CATTAAAACGAGAACCGGGGGTTTCAGGAAACTCAGCATG
GAAAGTGCTTTGTTCGTGTATTTGTTCTGTCGGTACATGA
AAACACATTTCAAGTGAAAATGGAAGCGATTAAAAGGTTG
TGGGTTTGATTAAGATGTTGAAAGTGGCTTTGTTTTTAAA
GGCTGTTGAAATATGAATCTCAGTTTTATTAGCGTTTGAT
TTTCGGTCATGCTGACCTAATAAAATAAAGGTTAGATGAG
TTTCATCCCATTCCAAAGTGGAAGATTGGAAATGAAAACT
CTCGCAACAATGAATTTGCCCATCATGCATCACATTTTTA
ACAAAAGTTGATCCACACTCGGTTCATAACATGAAAACCA
TCCCTGTGATGAAAAGGAAACAGTCAAATGTGTGTTTTTA
CTTTAATAAAACCATATATTTTTTAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
coq5-201 Contained in:
[BAC] DKEYP-7C9 (1)

Genome Resources: Vega_Trans:OTTDART00000032563 (1),  Ensembl_Trans:ENSDART00000051644 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC078433 (1) 1570 nt
GenBank:DV594863 (1) 734 nt
CITATIONS (2)