header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-13931
Transcript Name: cnnm4b-202
Previous Names: cnnm4-001, cnnm4b-001, si:ch211-42h14.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000032522 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000032522|OTTDARG00000024822|ZDB-GENE-070705-181 cnnm4b|OTTDARP00000026337 CH211-42H14.1-001 LG_ CU024871.12 Danio rerio protein_coding NOVEL, 1804 bp
ATGGAGTGGGAAAGGGTGCACGCTAACTTTAATACTGTTC
CTCTGGAGTAGAGTCTGCGGGAGTAAAGCGGAATCCTTGG
GCAGCGACAGCCGGATCCTCGGCATGCGGCTGGAGAGGAG
CGACAAGCCGGCCATGACCACCGAGGACGGGATCATACAG
GTAACCGAGGAGAGCGACATCCAGCTCAGGTTCTATGGGC
TGCAGATCAGCAATGACACCTGGGCGCAGATTAAGTTCAT
GGAGCAGGGCGAGGACAGCAGCTCTGACTCCAACAGGACT
TGTGCAGACTTCACCAAAGACATCTCTGTGAGGACTAGTA
TGAGTGTGAACAGCCTGGGAACGTCTGGTGTGCTGGGAGT
CAAAATCAAACCACTTAGGAAAAGTGAGTCCCAGAGGGAT
TATGGGCTGTGCATCAGGCAGAACGGGAGGTGGTTTTCAC
TGGGAGAACATGATGGAAGGTTGCGTGTGGTGGAGGAGAA
GAAGTCCATGCTGCCCATATGGTTCCAGGTGATCCTGATC
TGCTGCCTCCTGGTGCTCTCAGGTATGTTCAGTGGGTTAA
ACTTGGGGCTGATGGCTTTGGATCCCATGGAACTGAGAAT
CGTCCAAAGCTGTGGGACGGATAAGGAGAAGAAGTATGCG
AGGAAGATTGAACCCATTCGTAGGAAAGGAAACTATCTGT
TGTGTTCGCTTCTTCTGGGAAATGTGTTGGTGAACACCAC
GTTAACCATCCTACTGGATGATCTCATTGGTTCAGGTTTG
GGCGCTGTGGTGGCATCAACCATTGGCATTGTTATCTTTG
GAGAGATTGTTCCTCAAGCGCTCTGCTCTCGCCATGGTTT
GGCAGTAGGTGCCAACACCATCCACGTCACTAAGTTCTTC
ATGTTTCTGACTTTTCCGTTGTCTTATCCCATTAGCAAGC
TTTTGGACTGCGTGTTGGGGCAGGAGATTGGCACGGTGTA
CAATCGGGAGAAGCTGGTGGGGATGCTGAAGGTGACCGAG
CCATACAATGACCTGGTGAAGGAGGAGATGAACATGATTC
AGGGCGCGCTGGAGCTGAGGACTAAAACTGTGGAGGACGT
CATGACTCCGCTTAATAACTGCTTCATGATCAATAGTGAT
GCAGTTTTGGACTTCAACACCATGTCGGAGATCATGGAGA
GCGGATACACGCGCATTCCTGTTTATGAGGATGAGAGGAC
CAACATTGTGGACATCCTGTTTGTGAAGGACCTGGCCTTT
GTGGATCCTGATGACTGCACCACTTTGAAGACCATCACTA
AGTTCTACAACCATCCGGTTCACTTTGTGTTTCACGACAC
CAAGTTGGATTCAATGCTGGAGGAGTTTAAGAAAGGTAAA
TCCCATTTGGCGATTGTTCAGAAAGTCAATAATGAGGGCG
AAGGAGATCCGTTTTATGAGGTGCTGGGATTGGTCACTCT
GGAGGACGTCATCGAGGAGATCATCAAATGCGAAATCCTG
GACGAGTCTGACCTCTACACTGATAACCGAAATAGAAAGA
AAGTTGCACACAATAAGAACAAGCGAGACTTTTCTGCCTT
CAAACATGAGAGTGAGTCTAAAGTGAAGATCTCCCCTCAG
CTGCTGCTGGCTGCTCACCGCTTCCTCGCTACAGAGGTCA
GTTTGTTCAGTCCGTCTCAGATCTCTGAGAAAATCCTGCT
GCGTATCCTCAAACACCCTGACGTGATCCAGGAGATCAAA
TTCAACGAGAATGACAAGAAATCTTCACACCACTACCTGT
ACCTGCGTGGCAAACCCGTGGACTACTTCATCCTCATCCT
GCAG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cnnm4b-202 Contained in:

OTHER cnnm4b-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000032522 (1)
  • Ensembl_Trans:ENSDART00000132406 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES No data available
    CITATIONS (2)