header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-1393
Transcript Name: pmch-201
Previous Names: pmch-001, si:ch211-260p3.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000009118 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000009118|OTTDARG00000008010|ZDB-GENE-041210-150 pmch|OTTDARP00000007858 CH211-260P3.3-001 LG_ BX510924.11 Danio rerio protein_coding NOVEL, 580 bp
GCCGAAGATCATGGCATCTTCCTACATAATCATCTTTGCA
CTTGCACTTTTTGTTGAGCTGACTACTCGCTCAATGGCTT
TGCCCAAATTTAAGATGGACGAAGAACATACGGACCAAGA
AAGAATGGTTTCAGTAGCAGGAGAAGATGATATAAGTGAA
TTAGGACCTGGGCAGCTTCCCTTCAGAAGACACCCCATCA
TAGAGGGTAGATTGGTGGATGAAGATGGAACAAAACGAAT
CTTCATACTTGCGGACACAGGAATTAAAGGAGGGAGGGAG
GGAAACCTCGCCTTTTCGAGAACCTTCTCTGAGCTGCTGC
CACATGGGTTAGAGCATGCTCTGGATGGATTCAGCACGAT
GGATGAGCAACGTAACGTAGAAGATGTCATTCCAGTGGGC
AGGCGGGACATCGACATGCTGAGGTGCATGGTAGGGAGAG
TATACAGGCCCTGCTGGCAAGCTTGAAAATGGAGCAGCTG
ACAAATTATCTACATGATGTTCCCAGCCATCCCTTGATCT
TGCAAGACACTCCAAATATAAACATGACGAGCAGAAATGT
ATGATTTAAGAAATACTGAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pmch-201 Contained in:

OTHER pmch-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000009118 (1)
  • Ensembl_Trans:ENSDART00000111650 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AL917583 (1) 378 bp
    CITATIONS (2)