header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-1392
Transcript Name: parpbp-202
Previous Names: parpbp-001, zgc:136263-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000009117 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000009117|OTTDARG00000008009|ZDB-GENE-060421-5714 parpbp|OTTDARP00000007857 CH211-260P3.2-001 LG_ BX510924.11 Danio rerio protein_coding NOVEL, 2219 bp
ACTAACATCTACTGGCGTCTTTTTGTTTTCCCCATATGGT
TCACATTAGAGACCTAGGACGCGTCTAAATATCAGTTTTG
GCAAAGATTGAATGTTGGTGGTTATGGAGGAAAGAATGAG
AACGATGGCCAGGGTCTTCAGGAGAGAGTGCCACAGGGTG
TTAGACTCTGAGAGAACCACTATCCAAGGGGCAGATGGGA
TGCTGATGGTCCTACAACTTGCTATAGCTGGAGTAAACAA
GCAGGAACGTGGGGACTTTGGCGTTGCCTTAAGTGAAGTC
TTGGCTGTCTGGAAGTACTTCCTTCTGGATAAGCTCCAGT
TATCCCACAAAGATATACCTCTTCCACAGAGCTATGACCT
CATCCGAAAAGAGTACGACTGCTTTTTGAAGCGCACCAAT
ACTGTGGACCTGATTGACGTCTTCAGTATGTTCAAGGAGC
TTCGGTTAAATGAGGACCCCGAGGAGCCCCTAACCACAAT
GCAAATGTTTCAATTTCTCTTTGGAGAAAATGAAAGTTCA
GAGAAACCAAGTCAACCAGTATGTCCTGCAACTCCATCCT
GCAAGGCTGCAGACTGTAGTCCACAAATACAGAGAGTTGT
CAGGAGGGTTTTTTGTTCTTATTTGGGCCTTCTGGTGAAT
TCAAAGAATGATCTCGCCCTCACATACACTCTGGACAATC
CCAATCGCTCGCTGGGCCACATCGCCTTCACTGATCTCAG
ACATGCCGCCTGCGACAGCGCCTCATCTCTTTTCCTGACA
GTAACATCATTTGTCAGAGCCATACAGCTGGGAGGAAAGG
GTTACGCCCCCCCTGAGTCCCACCCTTTAAGGAAGCATGT
AAAGGGTTTATCGGAATTTCTCAATTTTGTTGACCAGTGT
CAAGACATCTTAGGAGAAACCCCTAATCCAAGAGAGGCTG
GATGCAAACTGGTATCTAGTATTAGAGCTGCTCTGGTAAA
AGGTCGCAGTGCTGGAGATCCAGTGTACCTTGCAGCTGAG
GAGTCAACCAAAAGTCTCAAGGAAAGAATCGGTCAAATAC
ATGCCATGCACACTCAGTCAACAGTTGGCACAGGAATCAG
TCCAGCAAGGCCCAAAGCGTATGCTATTAACCATGCCACC
GCCTATGGAGGACGAGAGACGGTGAAGGTTTTGATGGCTC
TTTTGGATGAGGAGGCATTAGCTCTGCCCTGCAGGAACAA
GGCAGAACTGCTCTCTGAAGATCATGCAGCTATTAATGGC
AGCACTGGAGCTTGCCTACTTGCTCTTTATAAATCTCCAG
AAGCCCCCACGGGATCTTCTCCAAAGAGTTTACGGAACCG
CGTCTTGAGCCAACAAGAACATATCAAGTCCAAGGTTGTG
CGGCCAACAATTCGTTCTCAGTTTGCATGTACATACAAGG
AAGAGGAGCTGCCCCTCAACCGGGTGCTGGAGTTTCCCAG
CACTAGCCAAATTCCCACCTGTGTGCACCCTGCACCCAAA
AAAGCCAGCTCTGAGAGTGACAATGGGATGGACAATAGAT
TCAAAGAGGCCACAAACTTAAGGTGTGAAGGTCCTGGCCA
ATCCGCTCTGGGGGAACATAGTGGAAATGCCTGGAACCAA
ACAGGTGGGAAGTCAACCCAGCCAGAACCGCTCAGAAGAG
CAACCGGGACCTTGAAGAGAAAGCTCGCCAATAGAGAGTG
CACTGAGCAGGGAAGAGAGGAGAACCAGCCCCCTCAGAAA
AGGCCCCCTGCCAAGGCAGCCACTGGAGGCCCGGGGAAAA
GGAACAATAAAGCTGTCAGCAAGAAGCTCATTGCTGGTCA
GGGCAAACTGACTGGCTTTTTCAGATTGTAATTCACTCAC
CTGTCTCTTATTGACGATGCTCCGTTTTGGGACCATTGTT
GCATTTTATTTATTTGTAGTTTAAATGCATTTAAAGGGAT
AGATCAACTGAAATTTAAACAGGTTGTTTAAAACCTTTTT
TTTTTTTTTTTTTTGGAGCAAAACATCAAATGATTTTACT
CTCCCTTTTAATGCAATTTAGATCACATGAACATCACTGA
GAGCTTTTCTACAGATAATTGTGTGTGCGTGCGTGTGTGA
TGTACATCATTGAAGTTGGCAAAGAAACGCAGGCAGAGTG
ATATTGGTGTACCTTTTATGATGTATTTCTTTGTCCTCCT
TAAACACGAATTGTACTCTGCAGGTTTTAATAAACTTTAT
TTCAGTATTTCTTAAATCA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
parpbp-202 Contained in:

OTHER parpbp-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000009117 (1)
  • Ensembl_Trans:ENSDART00000134467 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BM956850 (1) 660 bp
    GenBank:BM957188 (1) 647 bp
    GenBank:BG728243 (1) 567 bp
    GenBank:AA549811 (1) 171 bp
    CITATIONS (2)