Transcript

parpbp-202

ID
ZDB-TSCRIPT-090929-1392
Name
parpbp-202
Previous Names
  • parpbp-001
  • zgc:136263-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000009117 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000009117|OTTDARG00000008009|ZDB-GENE-060421-5714 parpbp|OTTDARP00000007857 CH211-260P3.2-001 LG_ BX510924.11 Danio rerio protein_coding NOVEL, 2219 bp
ACTAACATCTACTGGCGTCTTTTTGTTTTCCCCATATGGT
TCACATTAGAGACCTAGGACGCGTCTAAATATCAGTTTTG
GCAAAGATTGAATGTTGGTGGTTATGGAGGAAAGAATGAG
AACGATGGCCAGGGTCTTCAGGAGAGAGTGCCACAGGGTG
TTAGACTCTGAGAGAACCACTATCCAAGGGGCAGATGGGA
TGCTGATGGTCCTACAACTTGCTATAGCTGGAGTAAACAA
GCAGGAACGTGGGGACTTTGGCGTTGCCTTAAGTGAAGTC
TTGGCTGTCTGGAAGTACTTCCTTCTGGATAAGCTCCAGT
TATCCCACAAAGATATACCTCTTCCACAGAGCTATGACCT
CATCCGAAAAGAGTACGACTGCTTTTTGAAGCGCACCAAT
ACTGTGGACCTGATTGACGTCTTCAGTATGTTCAAGGAGC
TTCGGTTAAATGAGGACCCCGAGGAGCCCCTAACCACAAT
GCAAATGTTTCAATTTCTCTTTGGAGAAAATGAAAGTTCA
GAGAAACCAAGTCAACCAGTATGTCCTGCAACTCCATCCT
GCAAGGCTGCAGACTGTAGTCCACAAATACAGAGAGTTGT
CAGGAGGGTTTTTTGTTCTTATTTGGGCCTTCTGGTGAAT
TCAAAGAATGATCTCGCCCTCACATACACTCTGGACAATC
CCAATCGCTCGCTGGGCCACATCGCCTTCACTGATCTCAG
ACATGCCGCCTGCGACAGCGCCTCATCTCTTTTCCTGACA
GTAACATCATTTGTCAGAGCCATACAGCTGGGAGGAAAGG
GTTACGCCCCCCCTGAGTCCCACCCTTTAAGGAAGCATGT
AAAGGGTTTATCGGAATTTCTCAATTTTGTTGACCAGTGT
CAAGACATCTTAGGAGAAACCCCTAATCCAAGAGAGGCTG
GATGCAAACTGGTATCTAGTATTAGAGCTGCTCTGGTAAA
AGGTCGCAGTGCTGGAGATCCAGTGTACCTTGCAGCTGAG
GAGTCAACCAAAAGTCTCAAGGAAAGAATCGGTCAAATAC
ATGCCATGCACACTCAGTCAACAGTTGGCACAGGAATCAG
TCCAGCAAGGCCCAAAGCGTATGCTATTAACCATGCCACC
GCCTATGGAGGACGAGAGACGGTGAAGGTTTTGATGGCTC
TTTTGGATGAGGAGGCATTAGCTCTGCCCTGCAGGAACAA
GGCAGAACTGCTCTCTGAAGATCATGCAGCTATTAATGGC
AGCACTGGAGCTTGCCTACTTGCTCTTTATAAATCTCCAG
AAGCCCCCACGGGATCTTCTCCAAAGAGTTTACGGAACCG
CGTCTTGAGCCAACAAGAACATATCAAGTCCAAGGTTGTG
CGGCCAACAATTCGTTCTCAGTTTGCATGTACATACAAGG
AAGAGGAGCTGCCCCTCAACCGGGTGCTGGAGTTTCCCAG
CACTAGCCAAATTCCCACCTGTGTGCACCCTGCACCCAAA
AAAGCCAGCTCTGAGAGTGACAATGGGATGGACAATAGAT
TCAAAGAGGCCACAAACTTAAGGTGTGAAGGTCCTGGCCA
ATCCGCTCTGGGGGAACATAGTGGAAATGCCTGGAACCAA
ACAGGTGGGAAGTCAACCCAGCCAGAACCGCTCAGAAGAG
CAACCGGGACCTTGAAGAGAAAGCTCGCCAATAGAGAGTG
CACTGAGCAGGGAAGAGAGGAGAACCAGCCCCCTCAGAAA
AGGCCCCCTGCCAAGGCAGCCACTGGAGGCCCGGGGAAAA
GGAACAATAAAGCTGTCAGCAAGAAGCTCATTGCTGGTCA
GGGCAAACTGACTGGCTTTTTCAGATTGTAATTCACTCAC
CTGTCTCTTATTGACGATGCTCCGTTTTGGGACCATTGTT
GCATTTTATTTATTTGTAGTTTAAATGCATTTAAAGGGAT
AGATCAACTGAAATTTAAACAGGTTGTTTAAAACCTTTTT
TTTTTTTTTTTTTTGGAGCAAAACATCAAATGATTTTACT
CTCCCTTTTAATGCAATTTAGATCACATGAACATCACTGA
GAGCTTTTCTACAGATAATTGTGTGTGCGTGCGTGTGTGA
TGTACATCATTGAAGTTGGCAAAGAAACGCAGGCAGAGTG
ATATTGGTGTACCTTTTATGATGTATTTCTTTGTCCTCCT
TAAACACGAATTGTACTCTGCAGGTTTTAATAAACTTTAT
TTCAGTATTTCTTAAATCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations