Transcript

ftr85-201

ID
ZDB-TSCRIPT-090929-13905
Name
ftr85-201
Previous Names
  • ftr85-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000032478 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000032478|OTTDARG00000024797|ZDB-GENE-070705-22 ftr85|OTTDARP00000026312 CH211-121A2.3-001 LG_ BX511260.11 Danio rerio protein_coding NOVEL, 1637 bp
GCTTGCCATACGGACTCCTCCTATTACAACCTCACATCAA
ATACTGTAGAGAGAGAGAAGCTCGCCGGACCACATTGGCA
AACGCCATACGCACTTTACGCTCGGTTTACTGTAACTGTA
AAATATGGCAGAAGAAGAAGCTGGTATTTTTGTTAACCAG
GAGCAGTTCAGCTGTCCTATCTGCATGGATCTCCTACGGG
ACCCCGTAACCATTCCTTGCGGACACAACTACTGTATGGA
GTGCATCAAGAGCTTCTGGGAGCAGAAGAGCCAGAGGAAG
CTGTGCAGCTGTCCGGAGTGCAGACAGAGCTTCAACCCGA
GACCTGCCCTCAACAAAAACACACTGTTCGCCGAAGTTGT
CGAGAAGATGAGACACACTGGGACCCGCTCACCTACTCTA
CCTGCTGCGGCCGGAGCTAAAGGTGACCAAGACACCGTCG
GAGAAAAGCTCTGTGAAAAGTTATGTGAGCAAGAGCTCAA
GCAATCCCAGAGGAGATGCCAGCAGGTTATAAGGCAGCGT
GAGACGGAGCTACAGGATCTGAGTCAGGCTGTAATCTTGC
TCAGGAGCTCTGCTCAAGAAGCAGTGGAGGCAACGGAGAA
GATCTTCAGCGAGCTCGTTCTTTCAATCGAGGCTCTGTGT
TTTGAGGTGACGGAGATGATCAAAGAGAAAGAGCAGGCGG
AATTGGATGAATCACATGGATTTATGGAGAAACTAGAGCA
GGAGATCGCGGAGTTCAAGAGGAGAGATGCTGAATATGAC
AGGCTTGCACAGCTTGAAGATAAAACCCAATTCCTGAAGG
GTTATGAAACGCTGTGCAGTCTGCCTGAGTTGCTGACCTC
TCCTGCAGTTCTGGTTAATCCAGACTTCTGTTTCGAGATG
GTGGCAAGAAAGCTCACGTACCTGAATGAGGAAATTAAAG
ACCTGTGCCAGAAGAAATTGGTGAAATTATCAAAAAAAGT
TACAAGACTCAAGTTCATCCCAACACCTGAACCAAAAGTC
AGAGAGCAGTTTTTGGAATATTCGGGCCCTCTAACACTCG
ACCTGAACACGGCTCACAAAAACCTCATCATCTGTCCAGA
TAATGTTCAGGCGACGTTCAGCAAGACTTATCTATCTGTC
CCTGACCACCCAGAGCGTTTTGACGGCTACTACCAGGTCT
TGTGCAGAGAGAGCGTGTCCGGACGGTGTTATTTCGAGAC
CGAGTGGAGCGGAAAGGGTCCGGTTCACATTGCAGTGTCC
TACGAAGACATCAGCAGGAAAGGAAAGAGCAGCCAGTGTG
CATTTGGACACAACGCTCAGTCCTGGAGTCTGGTGTGCTC
CGATGGCTCGTATGCGTTCTGGCACAATGGAAGAGAAACC
AAAATCCCCAAAACGCAGTGGGCTCACAGGGTTGGAGTTT
ACGTCGACCACTCTGCAGGGGTTTTGGCATTTTACAACAT
CACAGACTCAATGAATCTCATCCACAGAATCAGGGCTGCA
TTCGCTCAGCCGTTGTATCCAGGGTTTAGAATTAACCCGG
GGTCCAATGTGAGTCTTTGCTATCCACTTTAATGACGCTT
AATCCTTGTTGGTACTACTGTATACGCTTTTTTGGTAAGA
CTTTATAATAACTGCACACTATGAATCGTTTATTAAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations