Transcript

chgb-201

ID
ZDB-TSCRIPT-090929-13899
Name
chgb-201
Previous Names
  • chgb-001
  • si:ch73-355e4.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000032469 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000032469|OTTDARG00000024790|ZDB-GENE-070705-268 chgb|OTTDARP00000026307 chgb-001 LG_ CU075930.10 Danio rerio protein_coding KNOWN, 2778 bp
ACGAGCTTCTCTCTGCTCATCCAGCCCGAAAAAAATACGA
CAAAAGATCTGATCCGGATAACAAAGACAGGAGAAAACAT
CTGAGAGCATCATGAAGTTCGCGGCTTTTCTCTGCGTGTT
TGTTTTCCTCGCTGCGGATGGAGGGTCCATACCAGTTGAG
CAGGACAGCCGAAGAGAGGGGCTGCTTACCAAGTGTTTAG
TTGAGATCCTTTCGAAGGAGCTGTATAAGACCGATGATAC
TCCGCTGCATCCAGAATGCAGAAACATCCTCTCACAAGGA
TCTGATCATTCCAAAGATGTGAAAAATACTAAAGAACCAA
CTCAAGAGGAGCTGAAAAAACCAAGAGAAGAGTCTAAAGT
CAAAGATGAGGAACTCATTGACCATCTCCACAAGGCTGCT
GACAAACGGGAGGAGTTGGGTGATGAACGGAGCCAAGAAG
AGTTTCCAAGCTTCGTTAAAAGAACCAAAGACAGACGTGA
GGAAATGGACGACGAACGAAGTCAGGAAGAATTCCCAAGC
TTCATGAAAAGAGGAATCAAGGGTAAACGTGAGGGAATGG
ATGATGAACGAAGCCAGGAAGAGTTCCCGAGTTTCATGAA
GAGAAGACTAAAGGAAAAGCGTGAGGGAATGGATGATGAT
CGAAGTCAGGAAGAGTTCCCGAGTTTCATGAAGAGAAGAC
TAAAGGAAAAGCGTGAGGGAATGGATGATGATCGAAGTCA
GGAAGAGTTCCCGAGTTTCATGAAGAGAAGACTAAAAGAA
AAGCGTGAGGGAATGGATGATGAACGAAGCCAAGAAGAGT
TCCCAAGTTTCTATAAAAGATTCAACATGCATAAAAGAGA
AGATTCTGATGACAGAAGCCAGGAGGAGTTTCCTCAGAAA
AGATTTTTCTCTATGATTTACAAGCGTGACAATCCCGATG
AGGAGCGTAGCCAGGAGGAATTTCCTTTCTACGAGTATAA
AAGAAGTCATCTTCTAACCAGCCGGGAAAAACGCAACGAC
CTGGACTATGACAGAAGTCAAGAAGCCTTCCCAAGTTACA
TGATCAAAAGAACCTACGGGGACGGAGATGAAGAGGATGA
GGGGATAGAGAAGAGGATCTGGAAGCCAACCCACAGATAC
CACCATAAGAAAAAGCACCACAAACGCAGCGAGAATGGGG
ACATCGAAGAACCAGATTACGATAGAAGTCAAGAAGACTT
CCCGAGCTACGTCAACAAAAGAAACTACATGAATGGAGAA
GAAATGGACGAAGAAAGTGAGGAGAGAGAAAAGAGGATCT
GGAAGCCAACGCACAGATATCATCACAAGAAAAAGCACCA
CAAGCGCAGCGAGAATGGAGATATCGAAGATCCAGACTAT
GACAGAAGTCAAGAAGACTTCCCAAGCTACAACAAAAGGA
CCTACGGGGATGGAGATGAGATGGACGAAGAAAGTGAGGA
GATAGAGAAGAGGATCTGGAAGCCAACACACAGATACCAT
CACAAGAAAAAGCACCACAAGCGCAGCGAGAATGGGGACA
TCGAAGAGCCAGACTATGACAGAAGCCAGGAAGACTTCCC
AAGCAAAAGGAGTCAAGGTCACTACAAACAAACTGAGGAT
TTGGCGAACGCCCAACCTGAGGAGTCTGAAGAGCAAGATG
AGGATATTGCAAAGCGATACTGGAAGCCCACACACAGATA
TCACCACAAAAAACATTATCGCAACAAGCGTGGCGACTCC
ATAGAGCTCGAGGATGAAAGTGAAGCCAGCCAGGAGGCCG
AAGAGGAGCTCAACAAAGGACAACTGAGTTCAGCAGAAGC
TGCGCTGAGATACCTAACAAACAAAAAGAAGGAGTTAGAG
GAGCGTCTACTCAACAAAGGTGACGTCTATGAGAAACGCT
CTCCATGGATTGACAGAGGTTACTACCGACCAGCCTGGTA
CAAAAGAAGCCAGAAGGCAGGTGAAAGTATGGATCAGCAG
CCGTACCACACTCTAGAGGAGCTCGCCAAGACTCTCAGAT
ACAAAAGAGGCCTGATTTCACAAGAGGAATCACCGGAGGA
GGAAATCAGCGCCCCGCAACAGGAGTTAAAAGAACTTGAG
GAGCTGGCCTCTGAGGATCAACAGATGACAGAAACAACTT
AACCATTCAGAAAACCAGCCGAGATGTCATCTCTCTGTGT
TGCCTGTGTGTGATCCGCTTTAAATGAATGCATTATTATA
TGTCGTATCTGATTACAATCGCTTTAGGCATTTGTTATTC
CTGCAAGTCAAGTTTAATGTTTAATGTGAAAGCCAGAGAA
ACAAGAATAAGTCGGTATGCTTTAGTTTAGCTCACCATTC
ACGGTATTAACAAACCATTAAGTAACTCTACTAGCTTACA
TAACTACTAATTAGCTCCATATTAATAGTAAGTAAGTTTA
AATTAAAAGTGGGGTTTAGGTTATGGGTAGGGTTAGGGAT
GCAGAATAAGATCATACTTTATAATGAACAGTTAATATCT
TAATAATAGGCAGGTAATAAGCTAGTAGTTAATAGCATGA
AGTGAGACCTAAAGTGCTACCTAACAGTTTATAAAAAGCA
AAACTAGCTACATCATGTGAATATTCTCTCTTTATTAACA
TCTAAAAATAACCAAGAAAACAAAATGCCCATGTACTTTT
GACCGTGTTTAAGAGCATGCTACTGTACAGCAGTGAATGA
TGTAGTATGTGTTTAAAAAAAATGGTTGTCAATTATAATA
CACATCCCTGCATTGCTTATTGTTTGCATTTAATAAAAGG
TGTAATTATGGGACCAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations