ZFIN ID: ZDB-TSCRIPT-090929-13853
Transcript Name: metap2a-201
Previous Names: metap2a-001, metap2l-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000032419 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000032419|OTTDARG00000024746|ZDB-GENE-061013-5 metap2a|OTTDARP00000026276 CH211-95O16.1-001 LG_ CT573048.20 Danio rerio protein_coding NOVEL, 1419 bp
GAGTCCGCAGTCATGGAAGCGAACGGGCTGCCGGTGCCGC
CGGTAATGGACACACTGATCGTTAACGGGGAACGAGAAGC
CGAAGACCCAGCCAAGAAGAAAAAGAGGAAGAAGAAGAAA
AACAAGTCAGTTGTTTCCGCAGGACACAGCGAGCAGGTTG
ATGATGGCGAGCTGGAGGTGAAGAAACCACTAGAACAGCA
GAACCTGGAGGAGAAAGAGAGAGAAGAGGATGGAGAAGAA
GATGGTGAGGAAGCTGATAACACTTCAGGCAAAAAGAAGA
AAAAGAAGCCAAAGAAGAAGAAAGGACCCAAAACCCAAAC
GGATCCTCCAAGCGTCCCCATCTGTGATCTGTACCCCAGC
GGTGTGTTTCCAGTGGGTCAGGAGTGTGAATATCCTCCCT
CTCAGGACGGACGCAGTGCTGCGTGGAGAATGAGCGATGA
GGAGAAGCGAGTACTGGATGAAGCCAATGAGGAGATGTGG
AGTGATTTCAGACAGGCAGCAGAAGCTCATCGACAAGTGC
GGCGATACGTCAAAAGCTGGATTAAACCTGGCATGACTAT
GATTGACATCTGTGAGCGTCTGGAAGCCTGCAGCAGGAGG
CTCATTAAAGAGGATGGTCTGAACGCAGGTCTGGCTTTTC
CCACTGGCTGCTCTCTTAATAACTGTGCTGCTCATTACAC
TCCGAACGCAGGAGACCCGACAGTCCTGCGGTACGATGAC
GTCTGCAAGATCGACTTCGGCACACACATAAATGGCAGGA
TCATTGACTGTGCCTTCACCGTCACCTTTAATCCAAAGTT
TGACCATTTGCTAGAGGCAGTGGCAGATGCCACAAACACA
GGCATTAAGTGTGCAGGTATAGATGTGCGTCTCTGCGACG
TTGGAGAATCAATACAAGAGGTGATGGAGTCCTACGAGGT
GGAAATAGATGGCAAAACATACCAAGTCAAGCCTATTCGT
AATCTAAACGGACACTCTATTGGTCAATACCGGATACATG
CTGGAAAAACTGTGCCTATAGTGAAAGGAGGAGAAGCCAC
CAGGATGGAGGAGGGTGAGGTGTACGCTATAGAGACATTC
GGCAGCACTGGTAAAGGAGTGGTGCATGATGACATGGACT
GCTCACATTACATGAAGAACTTTGACGTTGGACACGTGCC
GATCAGGCTTCCCAGGGCAAAGCACTTGCTGAACGTGGTG
AATGAGAACTTCGGCACACTTGCATTCTGTCGCCGCTGGC
TGGACCGTTTGGGCGAAAGCAAATACCTGATGGCCCTGAA
GAACCTGTGTGACCTGGGCATCATCGACCCATACCCTCCT
CTGTGTGATACCAAGGGCTCGTACACAGCCCAGTTTGAAC
ACACCATCCTGCTCAGACCCACATGCAAAGAAGTGGTGAG
CCGTGGAGATGACTATTGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
metap2a-201 Contained in:
[BAC] CH211-95O16 (1)

Genome Resources: Vega_Trans:OTTDART00000032419 (1),  Ensembl_Trans:ENSDART00000125767 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CK694351 (1) 464 nt
CITATIONS (2)