Transcript

metap2a-201

ID
ZDB-TSCRIPT-090929-13853
Name
metap2a-201
Previous Names
  • metap2a-001
  • metap2l-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000032419 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000032419|OTTDARG00000024746|ZDB-GENE-061013-5 metap2a|OTTDARP00000026276 CH211-95O16.1-001 LG_ CT573048.20 Danio rerio protein_coding NOVEL, 1419 bp
GAGTCCGCAGTCATGGAAGCGAACGGGCTGCCGGTGCCGC
CGGTAATGGACACACTGATCGTTAACGGGGAACGAGAAGC
CGAAGACCCAGCCAAGAAGAAAAAGAGGAAGAAGAAGAAA
AACAAGTCAGTTGTTTCCGCAGGACACAGCGAGCAGGTTG
ATGATGGCGAGCTGGAGGTGAAGAAACCACTAGAACAGCA
GAACCTGGAGGAGAAAGAGAGAGAAGAGGATGGAGAAGAA
GATGGTGAGGAAGCTGATAACACTTCAGGCAAAAAGAAGA
AAAAGAAGCCAAAGAAGAAGAAAGGACCCAAAACCCAAAC
GGATCCTCCAAGCGTCCCCATCTGTGATCTGTACCCCAGC
GGTGTGTTTCCAGTGGGTCAGGAGTGTGAATATCCTCCCT
CTCAGGACGGACGCAGTGCTGCGTGGAGAATGAGCGATGA
GGAGAAGCGAGTACTGGATGAAGCCAATGAGGAGATGTGG
AGTGATTTCAGACAGGCAGCAGAAGCTCATCGACAAGTGC
GGCGATACGTCAAAAGCTGGATTAAACCTGGCATGACTAT
GATTGACATCTGTGAGCGTCTGGAAGCCTGCAGCAGGAGG
CTCATTAAAGAGGATGGTCTGAACGCAGGTCTGGCTTTTC
CCACTGGCTGCTCTCTTAATAACTGTGCTGCTCATTACAC
TCCGAACGCAGGAGACCCGACAGTCCTGCGGTACGATGAC
GTCTGCAAGATCGACTTCGGCACACACATAAATGGCAGGA
TCATTGACTGTGCCTTCACCGTCACCTTTAATCCAAAGTT
TGACCATTTGCTAGAGGCAGTGGCAGATGCCACAAACACA
GGCATTAAGTGTGCAGGTATAGATGTGCGTCTCTGCGACG
TTGGAGAATCAATACAAGAGGTGATGGAGTCCTACGAGGT
GGAAATAGATGGCAAAACATACCAAGTCAAGCCTATTCGT
AATCTAAACGGACACTCTATTGGTCAATACCGGATACATG
CTGGAAAAACTGTGCCTATAGTGAAAGGAGGAGAAGCCAC
CAGGATGGAGGAGGGTGAGGTGTACGCTATAGAGACATTC
GGCAGCACTGGTAAAGGAGTGGTGCATGATGACATGGACT
GCTCACATTACATGAAGAACTTTGACGTTGGACACGTGCC
GATCAGGCTTCCCAGGGCAAAGCACTTGCTGAACGTGGTG
AATGAGAACTTCGGCACACTTGCATTCTGTCGCCGCTGGC
TGGACCGTTTGGGCGAAAGCAAATACCTGATGGCCCTGAA
GAACCTGTGTGACCTGGGCATCATCGACCCATACCCTCCT
CTGTGTGATACCAAGGGCTCGTACACAGCCCAGTTTGAAC
ACACCATCCTGCTCAGACCCACATGCAAAGAAGTGGTGAG
CCGTGGAGATGACTATTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations