Transcript

kcnb2-202

ID
ZDB-TSCRIPT-090929-13692
Name
kcnb2-202
Previous Names
  • kcnb2-002
  • si:ch211-193n21.1-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000032155 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000032155|OTTDARG00000024556|ZDB-GENE-070912-170 kcnb2|OTTDARP00000026093 CH211-193N21.1-002 LG_ CT027743.12 Danio rerio protein_coding NOVEL, 691 bp
GCTGCGAGTGACAGGCTCCACACGCGACGCTTTCCGCTTT
TATAAACACTTTATCATGGCTTCGTGGCGAGAATAAGCAG
CAGTTTCGGTTTCATCCCAACTTCATCTTTCTGCCAATTC
GGCACGAGTTGTTTGTGAGGTTTGGTCTCCACAGAATGAA
GAGAACCGGCTGCCCTTCTAGCAGGGGTTCCACTGACGCC
TCTCTTCCCTGAGCTGATGGACGGGAAAACTACGGGCTGA
CCGGCTTCGTTTTGCTTGCAGAGGTAAAGGAAGACGAGGT
GAACGGCGGGAAGGTGCAACCATGGAGGGCCTCGTTTAAT
CTGGATTCCTCGCCATACTCCTAATTGACATTTTAATTAG
CATAACACTTGAGCAGCATCAATCATGGCTGAGAGGGCAA
ACTTTGGAGCTCAGAGGGTCTCCAGGCCACAGGGGTCTCT
CCCGCCAGAACCCATCGACATCATCCGGACCAAAGCCAGA
TCCAGAAGAGTCCGGATCAACGTGGGCGGCCTGGTCCATG
AGGTGCTATGGAGAACCCTGGACAGACTGCCGCGAACCCG
TCTGGGCAAACTCAGAGACTGCAACACCCATGAAACCTTA
ATGGAGATCTGTGACGACTACAGTCTGAACGACAATGAAT
ATTTCTTTGACAGGCACCCGGGTGCCTTTTCCTCCATTTT
AAATTTTTACC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations