ZFIN ID: ZDB-TSCRIPT-090929-13380
Transcript Name: pimr196-201
Previous Name: pimr196-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000031745 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000031745|OTTDARG00000024268|ZDB-GENE-070705-328 pimr196|OTTDARP00000025803 DKEY-183G16.2-001 LG_ BX663493.8 Danio rerio protein_coding NOVEL, 2683 bp
CGAGCAAAAGCGACGATCACAGTGTTTTTACCACGTTTCA
TTGATGCCGAGTTTGCCTTCTACTGCCACTGTCATGGCGA
ACAGCTCAACAGAAACGCAACCAAACAGGAAGAAGAATTG
CCTTTGTGCATTCTTCAAAAATAAACGGCTGGCTTTACAG
AAAGCCAGTCAGTGTCGACGTCGAGACTGTAAAGTATCTC
CTTTACAGCCTCCGTCTGACACAGAACCACCGGGTCCACA
GCCAGGCCCATCAACAGATAATCTTCAGCTTGGTCTGTCC
AGCTTTGAGTCTCTGGCTGTAGACGATCAGACAGATCTTC
AGTCTGGTCCGTCCGGCCTCAGGTCTCGAGCTGTAGACGA
TCAGCGTGATGTTCAGCCTGGTCCATCCAGCAATAAGCTA
ACCAACTTTGAAGAAAACAATCCAGAGCCAGCTGAAGAAA
CACAACCAAACAGGAAGAAGAATAGCCTTTGTGCATTCTT
CAAGAATAAATGGCTGGCTATACAGAAAGCCAATCAGTGT
CGACGTCGAGGCGGTAAAGTCTCTCCTTTACAGCCTCCGT
CTGACACAGAACCACCGGGTCCACAGCCAGGCCCATCAAC
AGACGATCTTCAGCTTGGTCTCTCCAGCAATAAAACAACA
AACTTTGAAGCAAACAGAGACACTGCAGAGCCAGCTGAAG
AAACACAACCAAACAGGAAGAAGAAAAGCCTTTGTGAATT
CTTCAAAAAGAAATGGCTGGCTTTACAGAAAGCCAATCAG
TGTCGACGTCGAGGCAATAAAGTATCTCTTTTACAGCCTC
CGTCTGACACAGAGCCAGTGGGTCTACAGCCAGGCCCATC
CAACCTCAAGACAACATCTGCAGAAGATAAGCATGATCTT
CAGTCTGCTCTGTCCAGCTTTGGGTCTCTGACTGTAGACG
ATCAGGCTGATCTTCAGTCGTGTCTGTCCGGCCTTGAGCC
TCTGGCTGTAGACATTCAGGCTGAACCTCAGCTTGGTCTG
TCCAGCTTTGAGCCTCTGGCTGTTAAAGATCAGGCTGATC
TGCAGTCTACTCCATCCAGCCTTGAGCCTCTGGCTGCTGT
AGACGATCAGACTGATCTTCAGCTTGGTCTGTCCAGTTTT
GAGCCTCAGGCTGTAGACGATCAGACTGATCTTCAGCTTG
GTCTGTCCGGCCTTAAGTCTCTGGTAGTAGTCGATCAGTC
TGATATTTATCCTGGTCTTTCCAGCAATAAGCCAGCAAAC
TCTGATGCAAAACCAGCCAATCCAGAGCCAGATGAAGAAA
AAGCAACAGATGTTGAGAAGAACAGGATCAATACATTCTT
CAACAAAACGTGGCAGACTGTAAAACCTGTACTCAAAAAG
AACAATGTGGTTAATCCACGGCCAGACACAGGTTCAGCTG
CTGCAGAGCCAAATCCACACACTTCTGAGTCAGATCCACC
TGCATCAGAGCCAGAACCACCCATTCCTAAGCCAGACTCA
CTTATCCCTGAGCCTGACTCGCCCATTCCTGAGCCTGATT
CACCCATTCCTGAGCCTGATTCACCCATTCCTGAGCCAGA
ACCACCTGTTCCTAAGCCAGACTCACCCATTCCTGAGCAA
GTAGTTCGATTACATCTGCAGGATCAAACTGACAATTCTT
CAGACAAAGAATCTTCAGATGAAGAATCTTCAGAAGATTC
CCAGCCTTGTTCGTCCAAGTTTGTTCGAGCACCTACCAAG
CACAGACGTATTGGAGACAAAAGCTGGTTGAGAACCATCG
CATCGCCAGGTCCAAATATCCTTCCATTTTCTGCAGTATA
CGAAGTTGGAGAGAAGCTTGGAGAAGGAGGCTTTGGCGAA
GTGTTTGTGGGGCTCCACAAACTTAATCAACAACAGGTTG
CCATCAAATTTGTGAAAAAGACAAGAGCAGACCGGTATAT
CAGAATTCCTGGGCTTTCCAAGCCGCTGTTGGCAGAAGTG
TCATTAAACCTGCTGCTGAATCAACAACCGATAAGCCCTT
ACATCGTTCACATGATAGACTGGTTTGATGAGGAACAACG
CTACATACTCATCATGGAGTACCCGCAACCCTGCGTGAAT
CTGCTCAGCTTTATAACTCAGAACAAAACAAAGAGTGAAT
CTGAGGCACGTAGCATTTTAAACCAAGTGGTCCTCGGATG
CAAGCACTGTCTCGACAGAGGTATCTTCCATCGGGACATC
AAGTTAAACAACTGCGTGATCAACACCGAGACACACCAAG
TCAAACTGATAGACTTTGGCTGTGGTGATCTCCTCAAGAG
TGTCTATGTTGGTGGATTTACTGGAGGATGCTGTCCACCA
GAGTATGTTGCGACCCTGGCATATCGGGCAGACCCAACAA
CGGCGTGGTCTCTGGGCTATCTGATGTACAAACTGATGTG
TGGCATCTACCCCTTTAAATCACTGGAAGACATGAAGACA
AACAGTCTGACTTTTCCATTGGGCCTATCCAGAGAATTCC
AGGATTTGATCTCGGGGTGCCTGATTACTGATCCAAACAA
AAGATCCACCGTAGATGACATCCTAAACCACGAGTGGTTT
CAGCAAATGCTAGCAGCAGGAGTCAGCACAACCTGCACGT
AACGGACATGAAAGAGTCTTCAATCAAGAATCTTATTGTA
AAGGGATAGCTCAGCCTATTAATAAAGAAGAATGTTCTGA
GGT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pimr196-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000031745 (1),  Ensembl_Trans:ENSDART00000135823 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EE308329 (1) 869 nt
GenBank:EE302759 (1) 865 nt
GenBank:BI672275 (1) 622 nt
GenBank:BI840720 (1) 547 nt
GenBank:EB936596 (1) 528 nt
CITATIONS (2)