ZFIN ID: ZDB-TSCRIPT-090929-13379
Transcript Name: pimr197-201
Previous Name: pimr197-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000031743 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000031743|OTTDARG00000024267|ZDB-GENE-070705-327 pimr197|OTTDARP00000025801 DKEY-183G16.1-001 LG_none CU459002.17,BX663493.8 Danio rerio protein_coding NOVEL, 1608 bp
CTGGCTGTAGACGATCAGACTGATCTTAAGCTTGGTCAGT
CCAGTTTTGAGTCTCTGGCTGTAGACGATCAGACTGATCT
TCAGCTTGGTCTGTCCGGCCTTAAGTCTCTGGTAGTAGTC
GATCAGTCTGATCTTTATCCTGGTCTTTCCAGCAATAAGT
CAGCAAACTCTGATCCAAAACCAGCCAATCCAGAGCCAGA
TGAAGAAAAAACAACAGATGTTGAGAAGAACAGAATCAAT
ACATTCTTCAACAAAACGCGGCAGACTGTAAAACCTGTAC
TCAAAAAGAACAATGTGGTTAATCCACGGCCGGACACAGG
TTCAGCTGCTGCAGAGCCAAATCCACACACTTCTGAGCCA
GATCCACCTGCATCAGAGCCAGAACCACCCATTCCTGAGC
CAGACTCACTTATCCCTGAGCCAGAACCACCCATTCCTGA
GCCAGACTCACTTATCCCTGAGCCTGATTCACCCATTCCT
GAGCCAGAACCACCTGTTCCTAAGCCAGACTCACCCATTC
CCGAGCAAGTAGTTCGATTTCATCTGCAGGATCAAACTGA
CAATTCTTCAGACAAAGAATCTTCAGATGAAGAATCTTCA
GAAGATTCCCAGCCTTGTTCGTCCAAGTTTGTTCGAGCAC
CTACCAAGCACAGACGTATTGGAGACAAAAGCTGGTTGAG
AACCATCGCATCGCCGGGTCCAAATATCCTTCCATTTTCT
GCAGTATACGAAGTTGGAGAGAAGCTTGGAGAAGGAGGCT
TTGGCGAAGTGTTTGTGGGGCTCCACAAGCTTAATCAACA
ACATGTTGCCATCAAATTTGTGAAGAAGACAAGAGCAGAC
CGGTATATCAGAATACCTGGGCTTTCCAAGCCGCTGTTGG
CAGAAGTGTCATTAAACCTGCTGCTGAATCAACAACCGAT
AAGCCCTTACATCGTTCACATGATAGACTGGTTTGATGAG
GAACAACGCTACATACTCATCATGGAGTACCCGCAACCCT
GCGTGAATCTGCTCAGCTTTATAACTCAGAACAAAACAAA
GAGTGAATCTGAGGCACGTAGCATTTTGTACCAAGTGGTC
CTCGGATGCAAGCACTGTCTCGACAGAGGTATCTTCCATC
GGGACATCAAGTTAAACAACTGCGTGATCAACACCGAGAC
ACACCAAGTCAAACTGATAGACTTTGGCTGTGGTGATCTC
CTCAAGAGTGTCTATGTGGGTGGATTTACTGGAGGATGCT
GTCCACCAGAGTATGTTGCGACCCTGGCATATCGGGCAGA
CCCAACAACGGCGTGGTCTCTGGGCTATCTGATGTACAAA
CTGATGTGTGGCACCTACCCCTTTAAATCACTGGAAGACA
TGAAGACAAACAGTCTGACTTTTCCATTGGGCCTATCCAG
AGAATTCCAGGATTTGATCTCGGGGTGCCTGATTACTGAT
CCAAACAAAAGATCCACCGTAGATGACATCCTAAACCACG
AGTGGTTTCAGCAAATGCCAGCAGCAGGAGTCAGCACAAC
CTGCACGAAACGGACATGAAAGAGTCTTCAATCAAGCAAA
CTTATTGTAAAGGGATAGCTCAGCCTATTAATAAAGAAGA
ATGTTCTG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pimr197-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000031743 (1),  Ensembl_Trans:ENSDART00000074113 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EE308329 (1) 869 nt
GenBank:BI840720 (1) 547 nt
GenBank:BQ480961 (1) 467 nt
GenBank:BQ481202 (1) 419 nt
CITATIONS (2)