ZFIN ID: ZDB-TSCRIPT-090929-13347
Transcript Name: zwilch-002
Previous Name: si:ch211-242m18.4-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000031531 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000031531|OTTDARG00000023369|ZDB-GENE-050420-101 zwilch|no_translation CH73-94F11.1-002 LG_none CT863714.10,CT954222.5 Danio rerio protein_coding KNOWN, 887 bp
ATGTAATATGCACTGTTTACCATTTCTCTCTGTCTGTTTT
AGGTTATGCCAAGATGAAAGTAAAGACAACTGCACGTATA
TGGATGACGTTTCAGTGCTGCTTGTGAAGAAGGAACAGCT
TTTGCACGACATAATCGGTGAAAAAAATCAGCCCATCTTC
ATCTGCGAGAAAGCACAAACCAAGTATGAACCCGAAGCTA
CAGAAACGTCAGCAGACACCAGTGATGTTGAAGACGTTCT
CTTTAAAGTGGAGCAGGATCCGGGGCCACAGCCTCTCTCC
ATCATGAAAGCAAGACAACTGTTGTCATGGTACACCATGG
CTCATAACCCCAACATGAGCCGACTGAAAGCCCCAGAGAA
TCTGCACCCTCTCTGGGTTCGTTGTGACAAGTCGGACCCA
TGTGCCACTGCCTGGCTTGGAGTAGAAATCACCTACAGTG
GGAACAAAACCAGTGGTGTCAAATTGTACACGGTCTGCTG
CAAAGGTCCAACAGGAGATGAAACTGCGTTCACCACTTTG
GATGAGCTTAAGCAAGAGCATCAGAACAGACACCATACTT
CTGCAGTATCAACCAAAGGCTATGCACAGTACAACCTGTT
TTGCTCTTTAACAGAGGAGAGCTTGATGTTTGAGTCTCAG
AGCAGTGTAATCGCAAGCCTCACATGGAACCATGTGGAGA
AAATGTTGGAGTGTCCACCATTGTCTTCTAAAGCAACTCT
GAATATCAAAGTTGCAGTTGGAGACATAAGAAGTCCATTG
TATCAGACCTACAGAGAGATGGAGTTCCTCCTGGCTCTGG
CAGGCGGTTTGCGAACAGGAGAAATCGAATGGTTGGAACC
AGTGGAGACTCAATCTGCAGTGGACCTGACCAGAGCACTG
ATAGAGG

zwilch TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA zwilch-201 (1)    Ensembl 1984
ncRNA zwilch-002 887
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zwilch-002 Contained in:
[BAC] CH73-94F11 (1), CH73-204N23 (1)

Genome Resources: Vega_Trans:OTTDART00000031531 (1),  Ensembl_Trans:ENSDART00000134503 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EG582694 (1) 922 bp
CITATIONS (2)