Transcript

zwilch-002

ID
ZDB-TSCRIPT-090929-13347
Name
zwilch-002
Previous Names
  • si:ch211-242m18.4-002
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000031531 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000031531|OTTDARG00000023369|ZDB-GENE-050420-101 zwilch|no_translation CH73-94F11.1-002 LG_none CT863714.10,CT954222.5 Danio rerio protein_coding KNOWN, 887 bp
ATGTAATATGCACTGTTTACCATTTCTCTCTGTCTGTTTT
AGGTTATGCCAAGATGAAAGTAAAGACAACTGCACGTATA
TGGATGACGTTTCAGTGCTGCTTGTGAAGAAGGAACAGCT
TTTGCACGACATAATCGGTGAAAAAAATCAGCCCATCTTC
ATCTGCGAGAAAGCACAAACCAAGTATGAACCCGAAGCTA
CAGAAACGTCAGCAGACACCAGTGATGTTGAAGACGTTCT
CTTTAAAGTGGAGCAGGATCCGGGGCCACAGCCTCTCTCC
ATCATGAAAGCAAGACAACTGTTGTCATGGTACACCATGG
CTCATAACCCCAACATGAGCCGACTGAAAGCCCCAGAGAA
TCTGCACCCTCTCTGGGTTCGTTGTGACAAGTCGGACCCA
TGTGCCACTGCCTGGCTTGGAGTAGAAATCACCTACAGTG
GGAACAAAACCAGTGGTGTCAAATTGTACACGGTCTGCTG
CAAAGGTCCAACAGGAGATGAAACTGCGTTCACCACTTTG
GATGAGCTTAAGCAAGAGCATCAGAACAGACACCATACTT
CTGCAGTATCAACCAAAGGCTATGCACAGTACAACCTGTT
TTGCTCTTTAACAGAGGAGAGCTTGATGTTTGAGTCTCAG
AGCAGTGTAATCGCAAGCCTCACATGGAACCATGTGGAGA
AAATGTTGGAGTGTCCACCATTGTCTTCTAAAGCAACTCT
GAATATCAAAGTTGCAGTTGGAGACATAAGAAGTCCATTG
TATCAGACCTACAGAGAGATGGAGTTCCTCCTGGCTCTGG
CAGGCGGTTTGCGAACAGGAGAAATCGAATGGTTGGAACC
AGTGGAGACTCAATCTGCAGTGGACCTGACCAGAGCACTG
ATAGAGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations