header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-13332
Transcript Name: si:ch211-260p3.6-001
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000031493 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000031493|OTTDARG00000024048|ZDB-GENE-070705-154 si:ch211-260p3.6|no_translation CH211-260P3.6-001 LG_ BX510924.11 Danio rerio processed_transcript PUTATIVE, 487 bp
GATAATAATCTGCAGTCCCATTCCTAACCCTACAGGGTAG
CTTCCTCCACTCGACCATGACGCATGTGTGGTGGGGGAGA
CAGACACAGTGCTTTTTGTGCTTCAACAGTTGATCCCTGA
AGATGAAGACAAGTATGGGAAACTAAAGTGCATAAGAGAA
CACAAAACTCTCTAAGCGGCACACAAGGTTCCTCTCAGCA
TGTTCAAGGCAAACAAAGGCCAGCCAACTGATAGAACCTC
ATTTACCCTGAACTCAATGAATTCCAGCACAGAGTGACCT
GGTTGCTCGCTTTGTGGTTTCGCCTAGAGGATGATTTGGC
ATGTGCTGGGTCTGATGTGGAGGAATATGTTGTAACCTGG
TAGCCTAATCTTTTAGCATGAATGGAACAGTTGCGTAGTT
GTTCCTACACCATCTGTAGAGCAACCACAACCTGTCAATC
TGTTAAAGGTTGTGCTAATCCATTAAACGCTCTCTTTTCC
TGTTGGA

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-260p3.6-001 Contained in:

OTHER si:ch211-260p3.6-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000031493 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH509026 (1) 590 bp
    CITATIONS (1)