Transcript

kcnj8-201

ID
ZDB-TSCRIPT-090929-1333
Name
kcnj8-201
Previous Names
  • kcnj8-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000008879 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000008879|OTTDARG00000007817|ZDB-GENE-060308-1 kcnj8|OTTDARP00000007664 kcnj8-001 LG_ BX571719.3 Danio rerio protein_coding KNOWN, 1251 bp
ATGTTGCCGCGGAAGAGCATCATCCCGGAGGAGTTCGCGC
TGCCGGCGCTGGTGTCCCGGGTGCCGCGTAAACCAGTGTT
CAGAGACCGCGTGAATAAAGCGCGCTTCATCGCCAAGAGC
GGCGCGTGTAACTTGGCGCACAAGAACATCCGTGAGCAGG
GCCGGTTCCTGCAGGACGTCTTCACCACTCTGGTGGATCT
GAAGTGGCGCTTCACGCTGGTCATCTTCACCATGACATTT
CTGTGCAGCTGGCTGCTGTTCGCCATGAGCTGGTGGCTGG
TGGCCTTCGGGCACGGAGATCTGGACACCGACCGTAAACC
TGCCGTGGAGCAGTGCGTCACCAATGTCAACTCTTTCACC
TCTGCCTTCCTGTTCTCCATCGAGGTGCAGGTGACTATAG
GTTTCGGAGGGCGTATGATAACAGAGCGGTGTCCCATCGC
CATCGCCTTTCTCATATTGCAGAACATCATTGGCTTGATA
ATAAATGCCGTCATGCTTGGCTGCATCTTTATGAAGACCG
CTCAATCCCACCGGCGTGCCGAAACCCTTATCTTTAGCCG
ACACGCAGTCATCGCTGTGCGCAACAACCGCCTCTGCTTT
ATGATCCGAGTGGGCGACCTGCGCAAAAGCATGATCATCA
ATGCAGTTGTGCGCCTCCAAGTGGTCCGGAAGACCATGAC
CCCAGAGGGCGAGGTCATCCCCATCCAGCAGATCGATGTC
CAGACTGAGAGTGCAGTGGCTGGTAACAGCATCTTTCTTC
TGGCACCCTTGATCATATGTCATGTCATTGATAAAGACAG
TCCTCTGTACGATCTGTCGGCGATGGAGCTGCAGTGCAGT
GATCTGGAGGTCATCGTGATCCTGGAAGGAGTGGTGGAGA
CCACAGGCATCACCACTCAGGCTCGCACCTCCTACGTGAC
CGAGGAGATCCAGTGGGGACACAGATTCGTGCCTATAGTG
ACAGAGGAAGAGGGTGTCTACTCAGTGGACTACTCCAAGT
TCGGGAATACAGTCAAAGTGGCCACCCCTCGCTGCAGCGC
TCGTGAGCTGGACGAGAAACCCTCCATCCTGATCCAGACG
CTGCAGAAGAGCGAGCTTTCACACCAGAACTCTCTGCGCA
AGAGGAACTCTATGCGCAGGAACAACTCCATGCGCAAGGG
CAACTCCATGCGGCGCAATAATTCAGCTCTCGCTGTGCCC
AAAGTGCAGTTCCTCACCCCTGAGGGCGGAGCCAATCTAG
CGGTCACATGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations