ZFIN ID: ZDB-TSCRIPT-090929-13219
Transcript Name: acbd5b-202
Previous Names: acbd5b-001, si:ch211-112d19.6-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000031306 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000031306|OTTDARG00000023944|ZDB-GENE-070705-18 acbd5b|OTTDARP00000025446 acbd5b-001 LG_ CR956623.8 Danio rerio protein_coding NOVEL, 1285 bp
AGATGCAGACCTGTCCATGATATTAAGGGGAATGGAAGAT
TCCAAATCTGCTCAGAAGAGGTTTGAAGCAGCCGTAAAAG
TGATTAGAAGTTTACCTGAAGATGGCTCTTATGACCTGTC
CGATGATATGCTGGTTTTGTTCTACAGTTACTACAAACAG
GCTACAGAAGGACCCTGTAACACCCTAAAACCAAACTCTT
GGGATCCTATTGGAAAAGCTAAATGGGAGGCATGGAAAGA
CTTGGGAAACATGTCAAAGGATCAAGCCATGACGGAATAT
GTTCAAGAAATACAACTGATAATAGAAACCCTCCCGGTCA
CGGATAGGATGGCAGAATTATTGGATGCTCTTGACCCATT
TTATGAGATTGTGGAAGATGATGATGATGATGATGATGAA
GGTGTCAGTAAAGCAGCACCGTTATTCACAGGAAGCACTA
ATGCTGATAAAGATGCTGAGAGAGATGAAGAAGTGGAAAG
TGAAAGTAAGGAGGGAAATCTAGATGATTACATGGAGTTG
GTGGAAAAACAGAAAGATTTGAGCTCCACTACTGGAGAGA
AAGGTAGTTTGCTGGTGTTTAATAGAAGTGAGGAGAACAG
CATCTCCTCCTTGACCGATGGCACTCACAGCTCTCTGAAC
ACTGTGGACGATGAGGAGGAACTGGTTTATGATGGCTCAG
ATGATGAGATGGACAGTGACTCAATGGATAAACCAGCAAC
ACCAGAGAAGGGTTCAGGAGTTCGCAGCGTGCGTTTGGCA
GATGGGAGTGTGGTTGGAGCCAACATGCAACACGGGGGAA
ACAGAGAGCCTCAGTGTGGGAGTCAGGATGGAAAACCGCA
GGGACTTATATCCCCCGTCCCCCACCCGCCGACTCTTGGA
ACAGTCCGAAATGACAGAATCTCAGCATGCAGTGGAAGAG
AGCGCGGTTGCCAAGGAGATGGTGGTCAGCGCGGGGAGAC
GGCAGACAGAATGGACAAACAGGCCATCAACACACAGATC
ACCACCATATTGTCGGAGCTGGAGGACAACATGCAGGATG
TTCTTCGCAGACTGACCACACTGGAACAGCTTACAGCGTC
ACAAGCTGAAATCTCTCCTTCCAAAACCTGGCACTCCGAC
AAACCAAAAAAGAGGCTGTCATGGTGGCCTTTAAACTCAT
CCCCCTTCACTGCAGTGCTAACAGTTCTCTGGCCATTTGC
TGTTCATTGGCTGGTGCAGTTTTACTTACAGAGGAGGAGG
AGGAGGTAAGGTTCTTCTGGGCTCTGGAAATCCTTGAAAA
TGCTT

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
acbd5b-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000031306 (1),  Ensembl_Trans:ENSDART00000140434 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AL919077 (1) 528 nt
GenBank:AL925678 (1) 399 nt
CITATIONS (2)