ZFIN ID: ZDB-TSCRIPT-090929-13159
Transcript Name: enpep-201
Previous Name: enpep-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000031146 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000031146|OTTDARG00000023821|ZDB-GENE-050309-218 enpep|OTTDARP00000025315 CH211-200O8.7-001 LG_none CT025771.7,CU041321.5,CR559943.6 Danio rerio protein_coding NOVEL, 3090 bp
ATGGAAAGCCTGGACTTCGAGAAGAAGGAAAAGCGGTACT
GTATCCGAGGAAAGCACGCTGCTATCATCTGTGCCGTCAT
CGTAGTGACAGGTGTAGCTGTGGGACTTGGAGTTGGCTTA
AGCTTGAATTCTTCATCCGAAAAGGAAACACCATTACCAA
CTCCATTACCCACAGAAGTGCCTGATGATCGCCCATGCAA
ACCATCTGAGAACACCAATGGCGGCTGGAGCAATTTCCGA
TTACCTGACTACATTCTTCCGTTCCATTACGATCTGCATA
TGGAGCCTGACCTCAACACGGACATCTACACTGGGGACGT
GTCTGTACATCTGAAACTGACTCAGCCCAGTCAGCACCTG
TGGCTCCACATCCGGGACACTTTTGTCACTGTGATGCCTT
CACTACAGCGCAGCAGCCCGTCTGGTGTGACCTCTGTCAA
GTTGAAGCAATGCTTTGAATACAAGCCGCAGGAGTACGTG
GTTGTGGAAGCGGCTGAGCAGTTGAGCGTTACAGGGCCGG
ATGAACACTACGTCCTCACTCTGCACTTCCAGGGCTGGTT
AAATGGCTCTCTGGTTGGCTTCTACAGGACCACGTATCAG
GAGAATGGAGTTACCAAGAAAATCGCTGCAACAGACCATG
AACCCACGGACGCTCGTAAATCTTTTCCATGTTTTGATGA
GCCCAACAAAAAGGCCACCTACACAATCTCCATCACCCAT
GACAGTACATATAAAGCACTGTCCAACATGCCTGTGGAGA
AAACAGAAAAACTTTCAGAACAAAAGACTAAAACATCCTT
CATGAAGTCAGTAAAGATGAGCACTTATCTGGTGTGTTTT
GCGGTGCATCAGTTCGATTTTGTGGAGCGGACCTCGAAAA
GAGGAATACCGCTGCGGATCTATGCTCAGCCTTTGCAGAT
CTCCACGGCTGCATATGCTGCAGATGTCACACAGGTCATA
TTCGATTACTTTGAGGAATATTTCGACATGGAATATTCAA
TACAAAAACTTGATAAGATAGCGATCCCAGACTTTGGGAC
AGGAGCGATGGAGAACTGGGGCTTGATCACTTACAGAGAA
ACCAACCTGCTGTTCGATGAGAAGGAGTCATCCTCGGTCA
ACAAGCAGCGAGTGGCCAGTGTCATTGCACACGAGCTTGT
CCATCAGTGGTTTGGAAATATTGTGACTATGGACTGGTGG
GATGACCTGTGGCTGAACGAGGGCTTTGCCAGCTTTTTTG
AGTATATTGGAGTGGAAGAAGCTGAGCATGACTGGGGAAT
GCGTGACGTCATGCTTATCAACGATGTATATCCTGTCATG
GTCGATGATGCCCTTCTCTCCTCGCATCCCATTATTGTGG
ATGTGTCGAGCCCAGCTGAGATCACATCTGTGTTTGATGC
CATCTCATATAACAAGGGAGCTTCTATTTTGCGAATGCTG
GAGGACTTACTTGGCCGAGAGACATTTAGGGATGGTTGTC
GAAGATATCTGAAGACCTACCTCTTCCAGAACGCAAAGAC
TTCAGACTTCTGGAAAGCCTTGGCTGATGAGAGTGGCTTA
CCCGTGGCAGACATTATGGACACATGGACCAAGCAGATGG
GTTATCCAGTGCTCAGTCTGACCAACACAGACACTGAAGC
TAAACTCACGCAGACCAGGTTTCTTCTGGACCCTAATGCT
GACCCTAGTCAGCCCACCACTCCACTGGGGTATAAATGGA
CTATTCCAGTGAAATGGAAAGCACTTGACTCCACAAACAA
CTCTTTTATATTTGAAAAAGGACAAACAGAGGCAGTCATT
AGTGGATACTCGCATGCTACCAATGGTCTTATCAAAGTCA
ACAAAGACCACATGGGCTTCTACAGAGTAAATCATCATGA
CCAAATGTGGAGCGATATTGCTGAACAACTTCTTATGGAT
CATCAGGTCTACGATGCAACTGACAGAAGCAGCTACATTG
ATGATATATTCGCATTAGGACGGGCAGATATGGTTGATTA
CGGGAATGCCTTCAATTTAACAAGATATCTGGCTGACGAA
ACCGAATATATTGTGTGGGATCGAGTTTCTGCTTCTATCT
CCTACGTGAGAGAAATGTTGGCTGATGATACAGTGCTGTA
CCCCTTATTTCAGAAATTATTCAGGGGTCACGTGCAGAAG
ATATCCAGAGAGCTTGGCTGGAAGGATGAGGGGAATCAAA
CACAGCGGCTGCTGAGAGAGATCGTTTTGGGCATTGCATG
TCAAATGGGTGACCAGGAAGCTCTTGACCAAGCCTCTGAT
ATTTTCAATAAATGGATTAAAGGAACAATCGGCAGTGTGC
CTGTGAACTTGCGTCTGCTGGTATATCGGTACGGCATGAT
GAACTCAGGAACAGAGGAGAGCTGGGAAATCATGTTCCAG
AAGTATCTGTCTGCCACTCTGGCCCAGGAGAAAGATAAGC
TGCTCTATGGTCTGGCTTCAGTCAAAAATATTCATCTGCT
TCATAGGTTGCTTGAAGCCACAAAAAATGAAAGCATCATA
AGGAGTCAAGATGTTTTTACTTTAGTGCAATACGTGTCAC
GAAGCTCTGATGGTAAAATTATGGCCTGGGACTGGATGAC
GCTCAACTGGGATTACCTGGTGAACAGATACACTATCAAT
GACAGAAATTTGGGCCGCCTGCCAGCCAGAATTACAACTA
CATACAGCTCTAATCTTCAACTGTGGAAGATGGAGCACTT
TTTTGCCCTGCACCCGAATGCAGGAGCAGGTGAGATGCCC
AGAAAGCAGGCACTGGAGACTGTGAAGAACAATATCGAAT
GGGTGGAAAGGAATAAGGATGAGATCCGGTTCTGGCTGGA
GAACAATGTGTCCTAGTACTAGAAGAACATTTTTTGCCCA
CCCCTCAAGTAATTAGGATTCACAAGTCAATGAATTGCTC
AGGGCAGCTTGAAAATGAATCTTTAGCAAAGAGCCATAAT
TGCGTTCATGACAGTTAAATGAAACAAAACGCTTTCTGGA
ACTACAGTAGGCATTACAAATCCTTTGGAACTGTACATTG
TTTCTTTATTTAATGTGTTGCAATTGACATAAAATGTTTT
ATTTGTAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
enpep-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000031146 (1),  Ensembl_Trans:ENSDART00000079655 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC091994 (1) 2120 nt
GenBank:CK127367 (1) 817 nt
GenBank:CK689084 (1) 801 nt
GenBank:AI943396 (1) 598 nt
GenBank:AI942956 (1) 588 nt
GenBank:AL914285 (1) 535 nt
GenBank:AL914283 (1) 533 nt
GenBank:AL914284 (1) 533 nt
CITATIONS (2)