Transcript

rgs1-201

ID
ZDB-TSCRIPT-090929-13056
Name
rgs1-201
Previous Names
  • rgs1-001
  • si:ch211-251n20.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000030965 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000030965|OTTDARG00000023704|ZDB-GENE-070705-145 rgs1|OTTDARP00000025192 rgs1-001 LG_ CT583686.6 Danio rerio protein_coding KNOWN, 936 bp
TCCAGAGCCATAAAGAGCCACCGAGTGAAGCAGAGACTCA
TGCCGAAGACACTGCTGACAGAGATGGCCATAAAGAGCCT
GTGGACGATGTGGACTCCTGGGGTGAGTCCATCGAGAAGC
TGCTGTCCTGTAAAGCGGGACAGGCGGCTTTCCAGGACTT
CCTGAAGTCGGAATACAGTGAGGAAAATATTCTGTTCTGG
CTGGCATGTGAGGAATATAAAAAGGTGACGAATGAGCCGG
AGATGATCAGCATGGCCAATCAGATCTACACTGAGTTTGT
GCAGACGGAAGCACCCAGACAGGTTAACATCGATTCTGGG
ACTCGCACAAATATAACAAACAGCATCTCGGAGCCAACAC
GAAGCTCATTTGACACAGCACAGAAGATGATCTTCAGTCT
AATGACCAGAGACTGCTATCCCAGGTTTCTGAAGTCCGAC
ATCTACCAGTCCATCCTGCAAAAGCATGGAAAGAGATGAC
TTCATAACTAGTGGCGTATCCAGAGTACCAGTTGCCATAA
ACATGTTTTTTTTTAATCTTGTTTTATATTTGGTAAGCAT
AATAAGTTTAGCTTTGGACTTTTAATATTGTTATTTGTGA
AGGAAAACACTCATTTCAGTGTCACTCTATAGGATGCAGT
CTGATTTTCATGTTCAGTTGCCCATTGATTGATTTTTCCT
CTTCACAGAAAATCAAACCAATTAATCACGTCTCATTTTA
AACCATAACAGAAAATTGTATAATCACCATCATATCATCA
AAAGAATGTTATAAATTATCCCGTGTGGGATTAAAGGATC
TGTTATGGGCCTGCAATTGCCTGGTAATCAGCATACTGTT
GAGAAATCCAGAAAAAGAGGATCTGAGCGCTCCTTTTTAC
ACATGTACAGCCAATTCTCCTACAGTTAGCTTCTGTAGTA
GTGCAACGTTTTTATT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations