Transcript

raph1b-201

ID
ZDB-TSCRIPT-090929-12947
Name
raph1b-201
Previous Names
  • raph1b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000030846 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000030846|OTTDARG00000023636|ZDB-GENE-090311-54 raph1b|OTTDARP00000025110 DKEY-1H24.3-001 LG_ BX005426.17 Danio rerio protein_coding NOVEL, 6134 bp
CGAGGAACGCTCAGCAATCTCCGTTCTCCGGGAGAGAGAA
TGGGAGAGGAAAACGAAATGTGTTAAAAGGAGACTAAATA
AACTGGATCGGGTGCATGAATATTTTACTTTTGTAGTAAA
AAAAACGATACTATTCACCATCAGGAACGTTGGATATTTA
CATTTATTACTCTTACAAAATATTTGTCGGCTGTTTTGTT
ACATTGAAGATCTCGTCGTCAGGGTACAAGTTAACCTCTG
TGGGAATTTGAGCTGTCTGAAAGAGAGCAACACTATACCA
AAGATATGGAGCAGGTATCAGATGATGAGCTGGACCATGC
TGCCGAAGAAGACAGCGATAAGGAGGACCAGGATCTGGAC
AAGATGTTTGGTGCCTGGTTGGGAGAACTGGACAAGCTCA
CACAGAGTTTGGATGATGGGCGTCCTGAGAAAGTACAAAA
AGCTCCTCTCAGACAGGAAACAAACCTTGCCAATTTCTCC
TATCGTTTCTCTATGTACAACATCAATGAAGCCATTAATC
AGGGTGAGACGGTGGACCTGGATGCTCTCATGGCTGACCT
GTGCTCAATAGAGCAAGAACTCAGCACCATAGGCAAACCC
ATAAGCAAGACCTTGGATGGCAAATCCAAACAAAGGCCTA
CAGGACGCTCAGCCAGCGCAAAACACAGCGGAGGGGGCAG
CAGTGGAGGAAGCACCAGCAGCAGTACCCGAGCCTCACCC
GCATCCACTGTTCGGGGTGGCAACAGTCAATCTCGACCCC
TGGCTTCCAACTTCTCCCTGGATGACATCACTGCTCAGCT
GGAAAAGGCGTCTTTGAGCATGGATGAAGCAGCGAAACAG
ACTTCTGAGTCTTCCTCCTCATCTTATTCATCTGCCAATC
CACCTTCTAACTCACATCATCGGCGAACAGGGTCAGTCGG
GACAGTCAGTGACCAGGAAGTGCGTTCTATCGGTCATTCA
TCCAGGTCAAGCGTCAACTCTGCCTCTGCATCCAGCATGG
ACTCCCTGGATATTCGAGGACAGGAGAACGAGACTCAGTC
ACAAAACCAAAGCCAGACTAGCACAGAGGAAGAGCAGGCT
GCCAAAGCGAAGGCTGAGAAAATACGTGTGGCTCTAGAGA
AAATTAAAGAAGCCCAAGTGAAAAAGCTGGTGATACGTGT
ACACATGTCAGATGAGAGCTCAAAGACCATGATGGTGGAT
GAGAGGCAAACGGTCAGGCAGTTGCTGGACAGTCTGCTGG
ATAAATCTCACTGCGGTTACAGTCCTGATTGGGCTCTGGT
GGAGACCATCCCTGAGCTACAGATGGAGAGAATTTTTGAA
GATCACGAGAACCTTGTAGAGAACTTGCTCAACTGGACCA
GAGACAGTCAGAACAAACTCATGTTCATTGAACGGATTGA
AAAGTATGCACTTTTCAAAAACCCTCAGAACTATTTACTT
GGGAGGAAGGAGACTTCTGAGATGGCAGACAGAAACAAGG
AGGCACTGCTAGAGGAATGTTTTTGTGGCAGCTCGGTGTC
AGTTCCTGAAATCGAAGGAGTGTTGTGGTTGAAGGAAGAT
GGTAAAAAGTCTTGGAAGAAGCGCTACTTTCTGCTAAGGG
CATCTGGCATCTATTTTGTGCCAAAAGGCAAAGCCAAGGC
TTCCAGGGATTTGGTGTGCTTCCTGCAGTTGGACCATGTT
AACGTGTATTATGGTCAGGACTACAGAAGCAAGTACAAGG
CCCCCACTGACTACTGCCTGGCCCTCAAGCACCCTCAGAT
CCAGAAAAAGTCACAGTACATCAAATATCTATGCTGTGAT
GATGTCAGAACTTTACACCAGTGGGTAAATGGCATCCGTA
TTGCTAAGTACGGGAAGCAGTTGTATGTGAACTACCAGGA
AGCTATGAAGCGAACAGAGGCTGCCTATGACTGGTCTTCT
CTCTCCAGCACCAGCATCAAGTCAGGAACAAGCTCAGTCA
GTATACCTGAGTCGCAGTCAAACCACTCCAGCCAGACAGA
CAGTGGTATGTCAGATGGTACTTCGTCCTCTCATGCCCGC
TCTCAAAGTGTGGTCAGTTCAATCTTTTCTGAGGCCTGGA
AGAGAGGAACTCAAATAGAGGAGAGCACTAAGGCAAGGCC
AGAATCAATCCGTTCTACTCATTCAAGCCATAGCAGTCAT
TCTTCTCATCACGTATCTCAACAGCAACATCTACACGCAC
AACAGCCACATGTGCATTCAATTCTACAATCACGTGGAAG
TGTCACCCAGGCTCCGGCACAGGCACCAACACAAACACTG
GCACAAGCACCACCCCAAGTGGCTCCAGCTCCACCACCTC
CTCCTCCACCTCCTCCTCCACCACCTCCTCCTCCTATTTC
CAGCATCCCTCACCATGCAACTCCTACCATGTTTGCCAAA
TACAGCACTATCACTCGGCTGCAAAATGCCTCTCAGGCTA
CAAGTCACCACAAGCCTCAGCCTCAAATTCAGCAGCAAGT
GCCACCAGTACCACCACCCTCCAAACCGCAGTCAAACAAT
ATTCCATCAGGTGCTAACATCCCACCCCCTCCTCCTCCAC
CTCCACCTGCCTCAATGCCTCCACCTGGTTCAGCCATGGC
TGTTTTGAAGCTCGGCCCTCCAGCTGCAGCAGTAATTCCA
CAGATCTCCCCTTCCCCCCCCTCACCTCCTCCACCACCAC
CTCCTCCTCCCATAATGCCAGTGCAGTCACAGCCTCAACC
ACCTCCTCCACCCATAATGCCCATGCAGTCACAGCCTCTA
CCGCCTCCTCCACCAATAACACCCATGCAGTCACACAATC
TACCACCTCCTCCACCCATGCAGTCACACGCTCTACCACC
TCCTCCACCCATAACACCCATGCAGTCACATGCTCTACCA
CCTCCTCCACCCATAACACCCATGCAGTCACATGCTCTAC
CACCTCCTCCACCCATAACACCCATGCAGTCACATGCTCT
ACCACCTCCTCCACCCATAACACCCATGCAGTCACATGCT
CTACCACCTCCTCCACCAATAATGCCCATGCAGTCAGAGC
CTCTACCGCCGCCTGCACAAATCATGCCCATGCAATCACA
TCCTCTTCCACCACCTCCACCTTTAGTGCAAATGCAGTCA
CAGCCCATGCCACCACCTCCTCCCACAGTGTCATTCCAAT
CACAGCCTTTACCACCTCCTCCACCCCCTCTCCAGGCTAA
TGGCCTTCCCCCTCCTCCACCTTTAATCACTAATGGGCTT
AAGCAGGCTTTTGCCCATAAATTTCCCAGCACACCACAGG
ATGTATTACCCCCAGCTAATCAAAACAATTTTCCTCCACC
TCCCCCACCACCACCACCTCCACCACTTGCACCTACGCTC
CCTCCTTACCAGCATGTTACTTCAACTTCAAATCCACCAC
CACCCCCACCACCACCACCTCCTCCCCCACCAGCCCCCAT
ACATCTAGCAAATCAACCTGCGGTTTTACCCAAATTTTTC
ACTGGTGGATTTCCACCTCAGAAAGCACCCAAACCTTCAT
GTGGCATTCTTCCAGTATCCCCAGTAGCTCCAGCACTTCA
ACCTCCACCACCGCCTCCTCCTCCACCTCCTCCTCCACCA
CCTGCACCATTGAAGAATCAGCCTCCACCTACACTGCCCA
AGCAGCACAGCCTCTCCAAGACACTGCCCTTCTCCAGTCA
AACTTCTTCAGTACCGTCTATGGTTAAGCAGCTTGCTAGT
CAATTTCCTGTTGCATCTCCTGCATTAACCAATCAAACAG
ATAGTCTCAAAGCTCCCCAGTCTCCACCTGCAGTGAAGGT
TAAGCCAAAATGGCAGCCTGTAGGTCAAGGCCAGCAGCAA
CAGAGGTCACCTGAATTTCCACCACCTCCACCAGACAATG
CCCTTGGCTTTGCTTCACCAACACCTCCACCACCACCACC
TCCTCCTCTTCCTCCAGGTCCTACTCCTCCTCCTCCCCCT
CCTCCTCCTCCTCTGATGTCAGGCTCCCCTATCAAAAAGT
CTCCCTCTGGCTCATCTGCAGGTGTTAAGAAACCACCGCC
AACTCCTCAGCGCAACTCCAGTGTGAAGTACGATGCCTCA
ACGGAATACCAGGAGTCCCGGAAGAACTTGGTGAGCAAGT
TTAACCCAAGTTCTGCTTCATCAACAACATCAACCTCCAG
CTGTTCACCCTCAAAGGAGCTCTCTGCAGGCCCTCAAGCA
CCCCCCAAACCAGGGAAGCTCAATCTGGCAAATCTTCCTT
TGGCTTTGCAGAACAAATTCAATCAGAACCGCCAGTCAGC
GGCAGACTTTCCATCTCCTCCACCCCCAGAAAATGATTTT
TTCCCACCTCCGCCAATAGAGTCCGACCTCCCTCCACCAC
CACCTCTTCCAGGGGATCTAAATGGTGTGTCTCCCAAAGT
GGCCGTAGTCAATCCTCAGCCTCAGCCTGCTTGGGGCAAA
AGTTCCCTAAAGAAGACACAACCTCCAGCATCACTTCGCT
GTAATAACACTGTTAGAGAGTCTCCACCACTCTCACCACC
TTCCATACACGGGGGGCCAATTCCCCATTCTCCCAAAGGC
ACCACACAGCCAAACTTTTTGGAGGACCTTAACAAGACAC
TGAAACGCAAGTCTTCAAGAGTCTCTGGAGACAAAGTGGA
CCCTGTGGCCACAATGGATGACATGGTTTTGCCACCACCT
CCCCCTGAACTTCTGCAGGACCAGCAGAGGCTCAGTGGCA
GTGGTTTCATGTCCGGGAACATCTCAGGCTATGCAACACT
ACGGCGAGGGCCTCCTCCTGCCCCACCCAAGCGGGACCAC
AGTACCAAACTTACAAACTAAGACAATTGTATCTTTTCTT
GAACACTCTTGCTTGCTAATTTCTTGTGTATCTCATAGAG
TTGTAGAGAAGAAGACTTTTTTTTTTTTTTTGCTATGCTT
AATGCTCATTCTGTACAAAAGCCTCAAAAATGTCAGCTTT
ACAGTGGCTTTGTGACAGTGTATCAGTTCCAATTCCAAAC
AACAAAGTGATTCCACTTCAACATATTGGTACTGCATGGA
AAACAAAACTGCATAAAAAAGAATCTCATTGATTTTCGGA
AAGATGAATGGTTTGAACTTTAAATTGAATTATTTTTATT
TGAATTTTTATATTATTTTTTTTTATATTATCAATTATTT
AATAATCTGAAGAGATTTTGTTATTTTAGATTGAAGTTTT
TTAAATGGTTGAATGATTGTTGTTTGAGGAGTATTATCAT
GGGTATGTCGTCATAAACAGCGAGTTTGCTTGGTTTAATA
GCTCAGCACAACTTCCACATTTATGTGGCAGACCCAGTGC
TAAGGTGATGCGTTTAGCATGTACCATGATCACTATTATT
CTCTGAGCCACTTTAAGTGAGTTTTAGTTGTAATTGTCAA
AACTGTAAAATGAAGGAGACGTTGTTCAGGGAGTTGTGTC
ATTGTCTAGTTCTGAGACTGTGGAATGTTTGCTTTTTTTG
ACTAGACTTGTTTCAATTGTAGATATTCTCATTTGCTGCA
GTATCTTTGTCTAGGTGAAACAAATGACTGCCTTGCTGTT
CTTTATTGGTCCTCACTTCGGCTGGTGAGCATTCAAGCTG
ACTTAGAAATGGTTGACTTTTAAGTCGTAACTGAATGACA
CAATCAATATTCACATAGATTTATCTTATATTCTGTATTA
TAACCATGTATTATTGGCTCATAAATACAGCCATGCCTTA
AAAAGATCTAAAACATGCTTATCAAACAACAGATCAAAAT
ATTGTCGCCTTACATGATACAGGCTATTACAAAAAAAAAA
GTGTCTTTTCCTGTATGTTTTACCTGATTTTCCCTGTTCA
GACATGCCATGCAACTGACATGAATATCACAGTGAGCACC
AATGTGTAATGGCTCTACATGAGCAACTTTGCATATTTAC
AAACAAGTATGCATCTTATTTCATTTTGAAGGATTTGTTT
ATTGAATGTATTTACAATATCATGGAACTTATCAAGATAA
GAAGTAACAAACTGAAGGTAATGTTAAATTATTAAGTATC
CGGTCTTGATACATGGAAGGTCTATGAACATCATGCTCTA
CATATCTCTCTGCAAAATGTGTAATTTAAAATGAAATTAT
ACATGTTGATATCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations