ZFIN ID: ZDB-TSCRIPT-090929-12794
Transcript Name: si:dkey-83f18.11-201
Previous Name: si:dkey-83f18.11-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030633 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030633|OTTDARG00000023500|ZDB-GENE-070705-496 si:dkey-83f18.11|OTTDARP00000024949 DKEY-83F18.11-002 LG_ CR318646.27 Danio rerio protein_coding NOVEL, 1166 bp
ACACAGTCTGAAGCTGCAAACAGAAACACCAGACTGAGGA
CAGAAACACACCAGCTCTGAAAAATGGGCCAATTTCTAGA
TTCCCTCCTCCTCCTCGTTGCTCTCTGCTCCATATCTGAA
TGTGTTCAGCGTCAGTATCACTTTATAAATGAGATGAAGA
CCTGGACTGAAGCTCAGAGATACTGCAGAGAGAAATACAC
AGATCTGGCCACCGTTGACAACATGAACGACATGATCCAG
CTGATGAAGAGTGTGAAAGTGAATGATAGAGGTGTCTGGA
TTGGTCTGCAGAGGAAATGGCAGTGGTCTTCAGGAGATCC
TGCTCTCTTTCTTCACTGGGGAAATGAACAACCAGACGGC
GCAGATGAGTGTGCTTTTATGAGAAATGGTCAATGGGAAG
ATGGGAAATGTAATGACTCCTGGATATTTGTCTGCTACAA
CATGAGCAGAGGACTGGTGTTTGTCAATCAGGCGATGACC
TGGAGAGCTGCTCAGAGTTACTGCAGACAGAATCACACTG
ATCTGGTCAGTGTGAGGAACCAGAATGAGAGTCAACAGCT
GGAGAAGTTCATTAATGACAGTCATAAATTTGCATCTGAA
GTCTGGATCGGTCTGTTCAGAGACTCATGGCAGTGGTCAG
ATCGGAGCAACTATTCATTCAGTTACTGGAATAATCAGGA
ACCAAATGATTACGGAGGGAAGGAAAATTGTACAGTAGTT
CAACCGAAGACTGAGGGACGATGGAATGACATCGTTTGTA
ATAACCTGTTTCCTTTTGTGTGTCATGAAGATAAACTGAT
TGTGATCCAGCAGAATCTGTCGTGGTCTGAAGCTCTGAGA
TACTGCAGACAGAATCATGTGGATCTGGTCTCGGTTCAGT
CAGTGGAGATGCAGTATAAGGTGATGAACGTGGTTAAACT
GGCGTCTACTGAGGCGGTGTGGTTGGGTTTACGTCACTCC
TGTGCTTTGGGCATCTGGTTCTGGGTGAGTGGACAGACCG
TGTGCTATCAGAACTGGGCTCCAGGGAACGGCACATCAGA
GGAGGACTGTGAGCCCACAGTGAGATCTGGAGCAGTTCAG
TCTGGAGGAAGTCAGACCTGGATCAGCCGTCCTGAAACTC
ACAAACTCAACTTTATCTGCAGAAACTATTAGGTGTGAAA
GACCTG

si:dkey-83f18.11 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA si:dkey-83f18.11-201 1166
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-83f18.11-201 Contained in:
[BAC] DKEY-83F18 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000030633 (1),  Ensembl_Trans:ENSDART00000137468 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC171481 (1) 1271 nt
GenBank:CA472374 (1) 895 nt
GenBank:EE684766 (1) 884 nt
GenBank:CN022314 (1) 832 nt
GenBank:DT068150 (1) 755 nt
CITATIONS (2)