Transcript

si:dkey-81n2.1-201

ID
ZDB-TSCRIPT-090929-12789
Name
si:dkey-81n2.1-201
Previous Names
  • si:dkey-81n2.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000030628 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000030628|OTTDARG00000023498|ZDB-GENE-070705-492 si:dkey-81n2.1|OTTDARP00000024944 DKEY-81N2.1-001 LG_ CU210845.4 Danio rerio protein_coding NOVEL, 1153 bp
GACAGAAACATCAGACTGAGGACTGAAACACACCAGCTCT
GAGAAATGGCTCAGACTCTATATATCCCTCTTCTCCTCAT
TGCTCTCTGCTCCATATCTGAATGTGTTCAGCGTCAGTAT
CACTTTATAAATGAGGGGAGGAATCAGACAGAAGCTCAGA
AATACTGCAGAGAGAAATACACAGATCTGGCCACTGTTGA
CAACATGAGTGACATGAACCAGCTGATAAAGAGTGTGAAT
AATGGAGGTGTTGAAAATATCTGGATTGGTCTTCAGAGGA
CAAGTGTTTATAAATGGCATTGGTCTTCAGGTGATCCTGT
GCTCTTTCTGAACTGGACATCTGGAGAACCAGCTGGCAGT
AATGAGTGTACTGTTATGCATAATGGACAATGGATTAATG
AGGCATGTAGTAACACTCGTTTCTTCATCTGCTACAACAT
GAGCACAGGACTGGTGTTTGTTGATCAGATGATGAACTGG
AGAGACGCTCAGAGTTACTGCAGACAGAATCACACTGATC
TGGTCAGTGTGAGAAACCAGAATGAGAATCAACAGCTGGA
GAAGTTCATTAATGACAGAAACTCATCTGGAGCAGAAGTC
TGGATCGGTCTGTTCAGAGACTCATGGCAGTGGTCAGATC
AGAGCAACTCCTCATTCAGATACTGGAATACTGGTGAACC
AAATAATGTTGAAGAAAGCTGTGCAGTGATTGGGAAGAAT
CCTCAGAGAGGATGGGCAGACGTCCTTTGTGATGGCCGCA
AGATTCCTTTTGTGTGTCATGAAGATAAACTGATTGTGAT
CCAGCAGAATCTGTCGTGGTCTGAAGCTCTGAGATACTGC
AGACAGAATCATGTGGATCTGGTCTCGGTTCAGTCAGTGG
AGATGCAGTATAAGGTGATGAACGTGGTTAAACTGGCGTC
TACTGAGGCGGTGTGGTTGGGTTTACGTCACTCCTGTGCT
TTGGGCATCTGGTTCTGGGTGAGTGGACAGACCGTGTGCT
ATCAGAACTGGGCTCCAGGGAACGGCACATCAGAGGAGGA
CTGTGAGCCCACAGTGAGATCTGGAGCAGTTCAGTCTGGA
GGAAATCAGACCTGGATCAGCCGTCCTGAAACTGACCGAC
TCAACTTCATCTGCAGAAACTACTGAGAGTGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations