ZFIN ID: ZDB-TSCRIPT-090929-12775
Transcript Name: si:dkey-83f18.7-201
Previous Name: si:dkey-83f18.7-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030614 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030614|OTTDARG00000023493|ZDB-GENE-070705-506 si:dkey-83f18.7|OTTDARP00000024932 DKEY-83F18.7-001 LG_ CR318646.27 Danio rerio protein_coding NOVEL, 1210 bp
TAAAATAATCACATATTCTGAAGTTCAGACAGAATCATCA
GACTGAGGACAGAAACACTCCACATCTGAGAAATGGCTCA
ATCTCTATTTTTCCCTCTTCTCCTCATTGCTCTCTGCTCC
ATATCTGAATGTGTTCAGCGTCAGTATCACTTCATAAATG
AGAACAAGAACTGGACTGAAGCTCAGAGATACTGCAGAGA
GAAATACACAGATCTGGCCACTGTTGACAACATGAACGAC
ATGATCCAGCTGAACAAGAGTGTGAATAATGTAAACAATC
AGAATATCTATATTGGTCTTCAGAAGACGAATGTTTCTAA
ATGGCATTGGTCTTCAGGTGATCTTGTGCTCTTTCTGAAC
TGGGCATCTGGAGAACCAAACAACAGTTATAATTGTGGCA
CAATAAAAAATGGACAGTGGTTTGCTGAGTCATGCAATAA
CACATGTTTCTTCATCTGCTACAACATGAGCAGAGGACTG
GTGTTTGTCAATCAGAACATGAACTGGACAGTCGCTCAGA
GTTACTGCAGACAGAATCACATTGATCTGGTCACTGTGAG
GAACCAGAATGAGAGTCAACAACTGGAGAAGTTCATTAAT
GACAGAAACTCATCTGGATCTGCAGTCTGGATCGGTCTGT
TCAGAGACACATGGCAGTGGTCAGATCAGAGCAACTCTTC
ATTTAGATACTGGGCTGCTAATTTTAAAGATTCTTCATAC
AGTGCCGCTATTCAACCAAACATATCAGGACAATGGGCTG
ACTACTCTAGTAATTACAACCAGTTTCCTTTTGTGTGTCA
TGAAGATAAACTGATTGTGATCCAGCAGACAAAGTCGTGG
TCTGAAGCTCTGAGATACTGCAGACAGAATCATGTGGATC
TGGTCTCGGTTCAGTCAGTGGAGATGCAGTATGAGGTGAT
GAACGTGGTTAAACTGGCGTCTACTGAGGCGGTGTGGTTG
GGTTTACGTCACTCCTGCGCTTTAGGCATCTGGTTCTGGG
TGAGTGGACAGACCGTGTGCTATCAGTACTGGGCTCCAGG
GAACGGCACATCAGAGGAGGACTGTGAGCCCACAGTGAGA
TCTGGAGCAGTTCAGTCTGGAGGAGATCAGACCTGGATCA
GCCGTCCTGAAATTGACAAACTCAACTTCATCTGCAGAAA
CTACTAAGAGTAAAAATGTAAGATTATGAGTTTCTTTCAT
TTTCATTAAT

si:dkey-83f18.7 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA si:dkey-83f18.7-201 1210
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-83f18.7-201 Contained in:
[BAC] DKEY-83F18 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000030614 (1),  Ensembl_Trans:ENSDART00000137830 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC171481 (1) 1271 nt
CITATIONS (2)