Transcript

si:dkey-83f18.7-201

ID
ZDB-TSCRIPT-090929-12775
Name
si:dkey-83f18.7-201
Previous Names
  • si:dkey-83f18.7-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000030614 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000030614|OTTDARG00000023493|ZDB-GENE-070705-506 si:dkey-83f18.7|OTTDARP00000024932 DKEY-83F18.7-001 LG_ CR318646.27 Danio rerio protein_coding NOVEL, 1210 bp
TAAAATAATCACATATTCTGAAGTTCAGACAGAATCATCA
GACTGAGGACAGAAACACTCCACATCTGAGAAATGGCTCA
ATCTCTATTTTTCCCTCTTCTCCTCATTGCTCTCTGCTCC
ATATCTGAATGTGTTCAGCGTCAGTATCACTTCATAAATG
AGAACAAGAACTGGACTGAAGCTCAGAGATACTGCAGAGA
GAAATACACAGATCTGGCCACTGTTGACAACATGAACGAC
ATGATCCAGCTGAACAAGAGTGTGAATAATGTAAACAATC
AGAATATCTATATTGGTCTTCAGAAGACGAATGTTTCTAA
ATGGCATTGGTCTTCAGGTGATCTTGTGCTCTTTCTGAAC
TGGGCATCTGGAGAACCAAACAACAGTTATAATTGTGGCA
CAATAAAAAATGGACAGTGGTTTGCTGAGTCATGCAATAA
CACATGTTTCTTCATCTGCTACAACATGAGCAGAGGACTG
GTGTTTGTCAATCAGAACATGAACTGGACAGTCGCTCAGA
GTTACTGCAGACAGAATCACATTGATCTGGTCACTGTGAG
GAACCAGAATGAGAGTCAACAACTGGAGAAGTTCATTAAT
GACAGAAACTCATCTGGATCTGCAGTCTGGATCGGTCTGT
TCAGAGACACATGGCAGTGGTCAGATCAGAGCAACTCTTC
ATTTAGATACTGGGCTGCTAATTTTAAAGATTCTTCATAC
AGTGCCGCTATTCAACCAAACATATCAGGACAATGGGCTG
ACTACTCTAGTAATTACAACCAGTTTCCTTTTGTGTGTCA
TGAAGATAAACTGATTGTGATCCAGCAGACAAAGTCGTGG
TCTGAAGCTCTGAGATACTGCAGACAGAATCATGTGGATC
TGGTCTCGGTTCAGTCAGTGGAGATGCAGTATGAGGTGAT
GAACGTGGTTAAACTGGCGTCTACTGAGGCGGTGTGGTTG
GGTTTACGTCACTCCTGCGCTTTAGGCATCTGGTTCTGGG
TGAGTGGACAGACCGTGTGCTATCAGTACTGGGCTCCAGG
GAACGGCACATCAGAGGAGGACTGTGAGCCCACAGTGAGA
TCTGGAGCAGTTCAGTCTGGAGGAGATCAGACCTGGATCA
GCCGTCCTGAAATTGACAAACTCAACTTCATCTGCAGAAA
CTACTAAGAGTAAAAATGTAAGATTATGAGTTTCTTTCAT
TTTCATTAAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations