ZFIN ID: ZDB-TSCRIPT-090929-12766
Transcript Name: si:dkey-83f18.5-202
Previous Name: si:dkey-83f18.5-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030605 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030605|OTTDARG00000023491|ZDB-GENE-070705-504 si:dkey-83f18.5|OTTDARP00000024925 DKEY-83F18.5-003 LG_ CR318646.27 Danio rerio protein_coding NOVEL, 1109 bp
GACAGAAACACACCAGCTCTGAAAAATGGCTCAATCTCTA
TATCTCCCTCTTCTCCTCATTGCTCTCTGCTCCATATCTG
AATGTGTTCAGCGTCAGTATCACTTTATACATGAGATGAA
GAACTGGACTGAAGCTCAGATTTACTGCAGAGAGAATTAC
ACAGATCTGGCCACTGTTGACAACATGAATGACACGATCC
AGCTGATGAAGAGTGTGAATGATGTACGTCTCTGGATTGG
TCTGCAGAGGAAATGGCAGTGGTCTTCAGGTGATCCTGCG
CTCTTTTTGAACTGGGCAAATCAACAACCAGATGGCAAAG
ATGAGTGTGCTTTTATGAGAAATGGAGAGTGGCATGATTG
GCCATGTAGTAACACCTTGTTCTTCATATGCTACAACATG
AGCAGAGGACTGGTGTTTGTCGATCAGAAGATGAACTGGA
CAGCCGCTCAGAGTTACTGCAGACAGAATCACATTGATCT
GGTCAGTGTGAGGAACCAGAATGAGAATCAACAGCTGGAG
AAGTTCATTAATGTCAAAAACCCATCTGGATCTGGAATCT
GGATCGGTCTGTTCAGAGACTCATGGCAGTGGTCAGATCA
GAGCAACTATTCATTCAGTTACTGGAATACTGATAAACTG
ATTGTGATCCAGCAGAATCTGTCGTGGTCTGAAGCTCTGA
GATACTGCAGACAGCATCATGTGGATCTGGTCTCGGTTCA
GTCAGTGGAGATGCAGCGTCGTGTGATGAACGTGGTTAAA
CTGGCGTCTACTAAGGCGGTGTGGTTGGGTTTACGTCACT
CCTGTGCTTTGGGCATCTGGTTCTGGGTGAGTGGACAGAC
CGTGTGCTATCAGAACTGGGCTCCAGGGAACGGCACATCA
GAGGAGGACTGTGAGCCCACAGTGAGATCTGGAGCAGTTC
AGTCTGGAGGAGATCAGACCTGGATCAGCCGTCCTGAAAC
TGACCGACTCAACTTCATCTGCAGGAATTATTAAAAGTGA
AAGACCGGTGTATGTTTCAAATTATCAACATTTAATTTGT
CATACTATTATAATATACTGTGTTTATTTATAGTGTATAA
TGACAAACTGTCATTTCAAGATCTACTGT

si:dkey-83f18.5 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA si:dkey-83f18.5-201 (1)    Ensembl 1191
si:dkey-83f18.5-202 1109
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-83f18.5-202 Contained in:
[BAC] DKEY-83F18 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000030605 (1),  Ensembl_Trans:ENSDART00000143622 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC133850 (1) 1573 nt
GenBank:EE684766 (1) 884 nt
CITATIONS (2)