ZFIN ID: ZDB-TSCRIPT-090929-12757
Transcript Name: si:ch211-272h9.3-201
Previous Name: si:ch211-272h9.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030589 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030589|OTTDARG00000023480|ZDB-GENE-070705-165 si:ch211-272h9.3|OTTDARP00000024913 CH211-272H9.3-001 LG_ CR847899.28 Danio rerio protein_coding NOVEL, 1168 bp
GAGAAACATCAGACTGAGGACAGAAACACACCAGATCTGA
GAAATGGCTCAGACTCTATATTTCCCTCTTCTCCTCATTG
CTCTCTGCTCCATATCTGAATGTGTTCAGCATCATTATTA
CTATATAAATGAGGGGAAGAACTGGACTGAAGCTCAGAGA
TACTGCAGAGAGAAATACACAGATCTGGCCACCATTGACA
ACATGAACGACATGATCCGGCTGAAGAAGAGTGTGAATGA
TGCACCTGTTGAGAATATGTGGATTGGTCCTCGGAGGACG
AATGTATATAAATGGCATTGGTCTTCAGGTGATCCTGTGC
TCTTTCTGAACTGGACATCTGGAGAACCAGCCGGCACTAA
TGAGTGTACTGTTATGAATAATGGACAGTGGGATAATGAG
GCATGTAATAACACTCGTGTCTTCATCTGCTATAACATGG
GCAGAGGACTGGTGTTTGTTGATCAGGAGATGAACTGGAG
AGCCGCTCAGAGTTACTGCAGACAGAATCACATTGATCTG
GTCAGTGTGAGGAACCAAAATGAGAGTCAACAGCTGGAGA
ACTTCATTAAAGACAAAAACTCACGTGGATCTCCAGTCTG
GATCGGTCTGTTCAGAGACACATGGCAGTGGTCAGATCAG
AGCAACTCCTCATTCAGATACTGGTATACTGGTGAACCAA
ATAATGCTGGAAATAATGAGAAATGTACAGTGATTGGCGC
ATATTCTCAGAGAGGATGGGCAGACGTTGCTTGTGATGAT
CGCCGGATTCCTTTTGTGTGTCATGACGATAAACTGATTG
TGATCCAGCAGAATCTGTCGTGGTCTGAAGCTCTGAGATA
CTGCAGACAGAATCATGTGGATCTGGTCTCGGTTCAGTCA
GTGGAGATGCAGCGTCGTGTGATGAATGTGGTTAAACTGG
CATCTACTAATGCGGTGTGGTTGGGTTTGCGTTATTCCCA
CATTTTTGGCATCTGGTACTGGGTGAGTGGAGAGACCGTG
TGCTATCAGAAATGGGCTCCAAAGTACGGCACATCAGAGG
AGGACTGTGAGCCCACAGTGAGATCTGGAGCAGTTCAGTC
TGGAGGAAATTGGCACTGGATCAGTCGTCCTGAAACTGAC
CGACTCAACTTCATCTGCAGAAACTACTGAGAGTGAAGAA
GTAAGATG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-272h9.3-201 Contained in:
[BAC] CH211-272H9 (1)

Genome Resources: Vega_Trans:OTTDART00000030589 (1),  Ensembl_Trans:ENSDART00000146083 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC171481 (1) 1271 nt
GenBank:EH434655 (1) 985 nt
GenBank:EH455927 (1) 963 nt
GenBank:DT068150 (1) 755 nt
CITATIONS (2)