ZFIN ID: ZDB-TSCRIPT-090929-12756
Transcript Name: si:ch211-272h9.6-201
Previous Name: si:ch211-272h9.6-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030588 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030588|OTTDARG00000023479|ZDB-GENE-070705-168 si:ch211-272h9.6|OTTDARP00000024912 CH211-272H9.6-001 LG_ CR847899.28 Danio rerio protein_coding PUTATIVE, 903 bp
GTCTCTGTCTTAGACACTGGTCCACTTGTTCTCTTGTGAT
TTTTCTGTGCAGTTCCCTCAAACAGGCGTGCCATGAAGGC
CAGACCCTCCCGGCGGATGTAGGACTTCCCGGCGAATGTG
TAGAGGACAGGGTTTATGCAGCTGCTGACGAAGGCCACGG
TGGAGGATGGATGCAGTCGCACACGAATTTCTCAGGCTTT
TTACTGTCGCTGAGGATGTTCCTGAAAGCTAAAACGGGTG
CAGAAAGTCCCAGAGCGAGAACCCAGAGTCCCACCAGCAC
CCGCGTCAGCATCTTCCGCTCTGTCTTCGCCCCTACTCGC
TTTGGCCACACGATCGCAACCAGCCGGTGCAGACTCATCA
GCATGATCATGAATATGGAGGCATACATGTTGGCGCAGCA
GAGGTAGTACAGGACTTTGCACAGCGCCAGGCTGAAAACC
CAACTTCGCTGAACCAGATACACCATGAAGAAGGGTGTGA
GCAGCATGAGGAAGCCATCAGCGAAGGCCAGGTTCAGGAT
CAGCAGGGTGGTGATGGAGCGACGCCGCGCTCGGGCCAAG
ATGCTCCACATGATAAAGACGTTCCCTGGGACGCCCAGGA
GGAAGACGAGGCTGAGGATTGCAGCACCAGTTATCGCTCC
GCCTTTGTTGTCCACGATGCTGCCTCTGCCGCTGGTATTG
TTGGAGAGATTTGTGGGATGTAGTGTTGAGGTGTAGAAAG
ATGGACTCTGAAGGGCCATTGGGATGGAGGATGGAGCGAT
CTCGAGAAAAGCAGAGGGGGACAGAAGGTTCAACGCCATC
TTGGCAACCTGAGGAGGGAATAATGAACGTATTGTAAGTT
TTGCAATTTTGGTAAATCTGCCCATAAGGGTGGCTGTCCA
TTAAAGGTTTTTTTGTTTGCCCT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-272h9.6-201 Contained in:
[BAC] CH211-272H9 (1)

Genome Resources: Vega_Trans:OTTDART00000030588 (1),  Ensembl_Trans:ENSDART00000133393 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH488558 (1) 912 nt
GenBank:EH514935 (1) 868 nt
CITATIONS (2)