ZFIN ID: ZDB-TSCRIPT-090929-12755
Transcript Name: si:ch211-272h9.4-001
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: pseudogenic transcript
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030587 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030587|OTTDARG00000023478|ZDB-GENE-070705-166 si:ch211-272h9.4|no_translation CH211-272H9.4-001 LG_ CR847899.28 Danio rerio unprocessed_pseudogene none, 387 bp
ATGGCTCAATCTCTATATTTCCCTCTTCTCCTCATTGCTC
TCTGCTCCATATCTGAATGTGTTCAGCGTCAGTATCACTT
TATAAATGAGGAGAAGACCTGGTCTGATGCTCAGAGATAC
TGCAGAGAGAAATACACAGATCTGGCCACTGTTGACAACA
TAAACGACATGATCCAGCTGAACAAGATTGTGAATTATGG
AGCTGTCTGGATTGGTCTTCAGGGTACAAATGACAGTAAA
TGGCATTGGTCTTCAGGTGATCCAGTGCTCTTTCTGAACT
GGGGATCTGGAAGGCCAGACGGCAGTGGTAATTGTACTGT
TATGAAAAATGGTTTGTTGAGACATGTGATAATCCCTCAT
CCTTCGTTTGCTACAACAGTAAGTACA

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-272h9.4-001 Contained in:
[BAC] CH211-272H9 (1)

Genome Resources: Vega_Trans:OTTDART00000030587 (1),  Ensembl_Trans:ENSDART00000140180 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH434655 (1) 985 nt
GenBank:CN022314 (1) 832 nt
GenBank:CF997417 (1) 765 nt
CITATIONS (2)